Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  J. K. Nunez, L. B. Harrington, P. J. Kranzusch, A. N. Engelman, J. A. Doud
Date :  16 Sep 15  (Deposition) - 28 Oct 15  (Release) - 06 Apr 16  (Revision)
Resolution :  3.35
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H
Keywords :  Adaptive Immunity, Crispr-Associated Proteins, Crispr-Cas Systems, Clustered Regularly Interspaced Short Palindromic Repeats, Integrases, Endodeoxyribonucleases, Endonucleases, Dna Binding Protein, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  J. K. Nunez, L. B. Harrington, P. J. Kranzusch, A. N. Engelman, J. A. Doudna
Foreign Dna Capture During Crispr-Cas Adaptive Immunity.
Nature V. 527 535 2015
PubMed-ID: 26503043  |  Reference-DOI: 10.1038/NATURE15760

(-) Compounds

    ChainsA, B, C, D
    EC Number3.1.-.-
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GeneYGBT, CAS1, B2755, JW2725
    Organism ScientificESCHERICHIA COLI (STRAIN K12)
    Organism Taxid83333
    ChainsE, F
    EC Number3.1.-.-
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GeneYGBF, CAS2, B2754, JW5438
    Organism ScientificESCHERICHIA COLI (STRAIN K12)
    Organism Taxid83333
Molecule 3 - DNA (29-MER)
    Organism ScientificENTEROBACTERIA PHAGE M13
    Organism Taxid10870
Molecule 4 - DNA (28-MER)
    Organism ScientificENTEROBACTERIA PHAGE M13
    Organism Taxid10870

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCDEFGH

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 5DS6)

(-) Sites  (0, 0)

(no "Site" information available for 5DS6)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5DS6)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5DS6)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5DS6)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5DS6)

(-) Exons   (0, 0)

(no "Exon" information available for 5DS6)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:256
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    24        34        44        54        64        74        84        94       104       114       124       134       144       154       175       185       195       205       215       225       235       245       255       265       275      

Chain B from PDB  Type:PROTEIN  Length:268
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163  ||   181       191       201       211       221       231       241       251       261       271        

Chain C from PDB  Type:PROTEIN  Length:254
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeee..eeeeee..eeeee......eee......eeee...eeeehhhhhhhhhhh.eeeee.hhhh.eeeee.....hhhhhhhhhhhhhh....hhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhhh.............hhhhhhhhhhhh..hhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    25        35        45        55        65        75        85        95       105       115       125       135       145       155       176       186       196       206       216       226       236       246       256       266       276    

Chain D from PDB  Type:PROTEIN  Length:253
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..............eee..eeeee....eeee.....eee.hhhhh.eeee...eeeehhhhhhhhhh..eeeee.hhh.eeeeee....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhh.............hhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63        73        83        94       104       114       124       134       144       154     ||179       189       199       209       219       229       239       249       259       269   
                                                                                                                   92|                                                               160|                                                                                                
                                                                                                                    94                                                                176                                                                                                

Chain E from PDB  Type:PROTEIN  Length:93
               SCOP domains --------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeeeee..hhhhhhhhhhh.eeee..eeeeeehhhhhhhhhhhhhhhh...eeeeeee......eeeeee....eeeeee..eeeeee.. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90   

Chain F from PDB  Type:PROTEIN  Length:94
               SCOP domains ---------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeeeee..hhhhhhhhhhh.eeee..eeeeeehhhhhhhhhhhhhhhh...eeeeeee......eeeeee....eeeeee..eeeeee... Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90    

Chain G from PDB  Type:DNA  Length:29
                 5ds6 G   1 TAAACACCAGAACGAGTAGTAAATTGGGC  29
                                    10        20         

Chain H from PDB  Type:DNA  Length:28
                 5ds6 H   2 ATTTACTACTCGTTCTGGTGTTTCTCGT  29
                                    11        21        

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5DS6)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5DS6)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5DS6)

(-) Gene Ontology  (14, 22)

Asymmetric/Biological Unit(hide GO term definitions)


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 5ds6)
(no "Sites" information available for 5ds6)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5ds6)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  CAS1_ECOLI | Q46896
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  CAS2_ECOLI | P45956
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  CAS1_ECOLI | Q46896
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  CAS2_ECOLI | P45956
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        CAS1_ECOLI | Q468963nkd 3nke 4p6i 4qdl 5dlj 5dqt 5dqu 5dqz 5ds4 5ds5
        CAS2_ECOLI | P459564mak 4p6i 4qdl 5dlj 5dqt 5dqu 5dqz 5ds4 5ds5

(-) Related Entries Specified in the PDB File