Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  FAN1 NUCLEASE BOUND TO 5' PHOSPHORYLATED P(DT) SINGLE FLAP DNA
 
Authors :  N. P. Pavletich, R. Wang
Date :  05 Oct 14  (Deposition) - 03 Dec 14  (Release) - 10 Dec 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.25
Chains :  Asym. Unit :  A,B,U,V,W,X,Y,Z
Biol. Unit 1:  A,X,Y,Z  (1x)
Biol. Unit 2:  B,U,V,W  (1x)
Keywords :  Nuclease, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  R. Wang, N. S. Persky, B. Yoo, O. Ouerfelli, A. Smogorzewska, S. J. Elledge, N. P. Pavletich
Dna Repair. Mechanism Of Dna Interstrand Cross-Link Processing By Repair Nuclease Fan1.
Science V. 346 1127 2014
PubMed-ID: 25430771  |  Reference-DOI: 10.1126/SCIENCE.1258973

(-) Compounds

Molecule 1 - FANCONI-ASSOCIATED NUCLEASE 1
    ChainsA, B
    EC Number3.1.21.-, 3.1.4.1
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPET15B
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    FragmentUNP RESIDUES 364-1017
    GeneFAN1, KIAA1018, MTMR15
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymFANCD2/FANCI-ASSOCIATED NUCLEASE 1, MYOTUBULARIN-RELATED PROTEIN 15
 
Molecule 2 - DNA (5'- D(P*TP*AP*GP*CP*CP*AP*CP*GP*CP*CP*TP*AP*GP*AP*CP*TP*CP*CP*TP*C)-3')
    ChainsX, U
    EngineeredYES
    SyntheticYES
 
Molecule 3 - DNA (5'-D(*GP*CP*TP*GP*AP*GP*GP*AP*GP*TP*CP*T)-3')
    ChainsY, V
    EngineeredYES
    SyntheticYES
 
Molecule 4 - DNA (5'-D(*TP*TP*TP*TP*TP*TP*GP*AP*GP*GP*CP*GP*TP*G)-3')
    ChainsZ, W
    EngineeredYES
    SyntheticYES

 Structural Features

(-) Chains, Units

  12345678
Asymmetric Unit ABUVWXYZ
Biological Unit 1 (1x)A    XYZ
Biological Unit 2 (1x) BUVW   

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric Unit (1, 2)
No.NameCountTypeFull Name
1CA2Ligand/IonCALCIUM ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLU A:815 , ASP A:960 , GLU A:975 , VAL A:976 , DC U:4BINDING SITE FOR RESIDUE CA A 1101
2AC2SOFTWAREGLU B:815 , ASP B:960 , GLU B:975 , VAL B:976 , DC X:4BINDING SITE FOR RESIDUE CA B 1101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4RIB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4RIB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4RIB)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4RIB)

(-) Exons   (0, 0)

(no "Exon" information available for 4RIB)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:615
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhh.hhhhhhhhhhhhhh....ee.hhh........hhhhhhhhhhh..eee.hhh.hhhhhhhh.hhhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eeeehhhhhhhhhhhhhhhh..................hhhhhhhhhhh...............hhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhh..................eeeeee.ee..ee.....hhhhhhhhhhhh....eeee.hhhhhhhhhhhhhhhhhh.....................hhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh.......hhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....eeee......eeeeeee......hhhhhhhhhhhhhh...eeeeeeee. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                4rib A  370 TGHPYYLRSFLVVLKTVLENEDDMLLFDEQEKGIVTKFYQLSATGQKLYVRLFQRKLSWIKMTKLEYEEIALDLTPVIEELTNAGFLQTESELQELSEVLELLSAPELKSLAKTFHLANPNGQKQQLVDAFLKLAKQRSVIGAVILKRAKALAGQSVRICKGPRAVFSRILLLFSLTDSMEDEDAACGGQGQLSTVLLVNLGRMEFPSYTINRKTHIFQDRDDLIRYAAATHMLSDISSAMANGNWEEAKELAQCAKRDWNRLKNHPSLRCHEDLPLFLRCFTVGWIYTRILSRFVEILQRLHMYEEAVRELESLLSQRIYCPDSRGRWWDRLALNLHQHLKRLEPTIKCITEGLADPEVRTGHRLSLYQRAVRLRESPSCKKFKHLFQQLPEMAVQDVKHVTITGRLCKSVFVMVLCSVEELALAHYRRSGFDQGIHGEGSTFSTLYGLLLWDIIFMDGIPDVFRNACQAFPLDLCTDSFFTSRRPALEARLQLIHDAPEESLRAWVAATWHEQEGRVASLVSWDRFTSLQQAQDLVSCLGGPVLSGVCRHLAADFRHCRGGLPDLVVWNSQSRHFKLVEVKGPNDRLSHKQMIWLAELQKLGAEVEVCHVVAV 1009
                                   379       389       399       409       419       429       439       449       459       469       479       489       499       509|      528       538       548       558       568       578       588       598       608       618       628       638       648       658       668       678       688       698       708       718       728       738       748       758       768       778       794    || 814       824       834       844       854       864       874       884       894       904       914       924       934       944       954       964       974       984       994      1004     
                                                                                                                                                                     509|                                                                                                                                                                                                                                                                         787|  799|                                                                                                                                                                                                       
                                                                                                                                                                      519                                                                                                                                                                                                                                                                          794   810                                                                                                                                                                                                       

Chain B from PDB  Type:PROTEIN  Length:628
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhh.hhhhhhhhhhhhhh....ee.hhh........hhhhhhhhhhh..eee.hhh.hhhhhhhh.hhhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eeeehhhhhhhhhhhhhhhh..................hhhhhhhh..................hhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhh.................eeeeeee.ee.....eeee..........eeehhhhhhhhhhhh....eeee.hhhhhhhhhhhhhhhhhh.....................hhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh.......hhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....eeee......eeeeeee......hhhhhhhhhhhhhh...eeeeeeee. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                4rib B  370 TGHPYYLRSFLVVLKTVLENEDDMLLFDEQEKGIVTKFYQLSATGQKLYVRLFQRKLSWIKMTKLEYEEIALDLTPVIEELTNAGFLQTESELQELSEVLELLSAPELKSLAKTFHLANPNGQKQQLVDAFLKLAKQRSVIGAVILKRAKALAGQSVRICKGPRAVFSRILLLFSLTDSMEDEDAACGGQGQLSTVLLVNLGRMEFPSYTINRKTHIFQDRDDLIRYAAATHMLSDISSAMANGNWEEAKELAQCAKRDWNRLKNHPSLRCHEDLPLFLRCFTVGWIYTRILSRFVEILQRLHMYEEAVRELESLLSQRIYCPDSRGRWWDRLALNLHQHLKRLEPTIKCITEGLADPEVRTGHRLSLYQRAVRLRESPSCKKFKHLFQQLPEMAVQDVKHVTITGRLCPQRKSVFVMEAGEAADPTTVLCSVEELALAHYRRSGFDQGIHGEGSTFSTLYGLLLWDIIFMDGIPDVFRNACQAFPLDLCTDSFFTSRRPALEARLQLIHDAPEESLRAWVAATWHEQEGRVASLVSWDRFTSLQQAQDLVSCLGGPVLSGVCRHLAADFRHCRGGLPDLVVWNSQSRHFKLVEVKGPNDRLSHKQMIWLAELQKLGAEVEVCHVVAV 1009
                                   379       389       399       409       419       429       439       449       459       469       479       489       499       509|      528       538       548       558       568       578       588       598       608       618       628       638       648       658       668       678       688       698       708       718       728       738       748       758       768       778       788 ||    801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001        
                                                                                                                                                                     509|                                                                                                                                                                                                                                                                            790|                                                                                                                                                                                                                       
                                                                                                                                                                      519                                                                                                                                                                                                                                                                             794                                                                                                                                                                                                                       

Chain U from PDB  Type:DNA  Length:20
                                                     
                4rib U    0 TAGCCACGCCTAGACTCCTC   19
                                     9        19

Chain V from PDB  Type:DNA  Length:12
                                             
                4rib V    1 GCTGAGGAGTCT   12
                                    10  

Chain W from PDB  Type:DNA  Length:7
                                        
                4rib W    1 AGGCGTG    7

Chain X from PDB  Type:DNA  Length:20
                                                     
                4rib X    0 TAGCCACGCCTAGACTCCTC   19
                                     9        19

Chain Y from PDB  Type:DNA  Length:12
                                             
                4rib Y    1 GCTGAGGAGTCT   12
                                    10  

Chain Z from PDB  Type:DNA  Length:7
                                        
                4rib Z    1 AGGCGTG    7

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4RIB)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4RIB)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4RIB)

(-) Gene Ontology  (24, 24)

Asymmetric Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4rib)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4rib
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FAN1_HUMAN | Q9Y2M0
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.21.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.1.4.1
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  FAN1_HUMAN | Q9Y2M0
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FAN1_HUMAN | Q9Y2M04rea 4reb 4rec 4ri8 4ri9 4ria 4ric 4rid 4ry3

(-) Related Entries Specified in the PDB File

4ri8 4ri9 4ria 4ric 4rid