Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)

(-) Description

Title :  A NUCLEASE-DNA COMPLEX FORM 3
 
Authors :  Q. Zhao, X. Xue, S. Longerich, P. Sung, Y. Xiong
Date :  22 Sep 14  (Deposition) - 24 Dec 14  (Release) - 14 Jan 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.20
Chains :  Asym. Unit :  A,B
Biol. Unit 1:  A (2x),B (1x)
Keywords :  Hjc, Tpr, Sap, Structure Specific Nuclease, Fancid2, Nucleus, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  Q. Zhao, X. Xue, S. Longerich, P. Sung, Y. Xiong
Structural Insights Into 5' Flap Dna Unwinding And Incision By The Human Fan1 Dimer.
Nat Commun V. 5 5726 2014
PubMed-ID: 25500724  |  Reference-DOI: 10.1038/NCOMMS6726

(-) Compounds

Molecule 1 - FANCONI-ASSOCIATED NUCLEASE 1
    ChainsA
    EC Number3.1.21.-, 3.1.4.1
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPMAT9S
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    FragmentUNP RESIDUES 373-1017
    GeneFAN1, KIAA1018, MTMR15
    MutationYES
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymFANCD2/FANCI-ASSOCIATED NUCLEASE 1, MYOTUBULARIN-RELATED PROTEIN 15
 
Molecule 2 - DNA (40-MER)
    ChainsB
    EngineeredYES
    Organism ScientificSYNTHETIC CONSTRUCT
    Organism Taxid32630
    SyntheticYES

 Structural Features

(-) Chains, Units

  12
Asymmetric Unit AB
Biological Unit 1 (2x)A (2x)B (1x)

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 3)

Asymmetric Unit (1, 3)
No.NameCountTypeFull Name
1IOD3Ligand/IonIODIDE ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1IOD-1Ligand/IonIODIDE ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREARG A:982 , HOH A:1401BINDING SITE FOR RESIDUE IOD A 1101
2AC2SOFTWAREGLY A:741 , TRP A:990BINDING SITE FOR RESIDUE IOD A 1103

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4REC)

(-) Cis Peptide Bonds  (1, 1)

Asymmetric Unit
No.Residues
1Lys A:516 -Pro A:517

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4REC)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4REC)

(-) Exons   (0, 0)

(no "Exon" information available for 4REC)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:593
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhh.hhhhhhhhhhhhh.....ee.hhh........hhhhhhhhhhh..eee.hhh.hhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhh.....hhhhhhhhhhhhhh.eeeehhhhhhhhhhhhhhhhhhhh......hhhhhh................hhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhh...hhhhhhhhh.hhhhhh.hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhhh...........eeeeee....hhhhhhhhhhhhh...eeee.hhhhhhhhhhhhhhhhhh.....................hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhh.............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eeee......eeeeeee......hhhhhhhhhhhhhh...eeeeeee.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                4rec A  371 EFPYYLRSFLVVLKTVLENEDDMLLFDEQEKGIVTKFYQLSATGQKLYVRLFQRKLSWIKMTKLEYEEIALDLTPVIEELTNAGFLQTESELQELSEVLELLSAPELKSLAKTFHLVNPNGQKQQLVDAFLKLAKQKPGIGAVILKRAKALAGQSVRICKGPRAVFSRILLLFSLTDSMEDEGLLVNLGRMEFPSYTINRKTHIFQDRDDLIRYAAATHMLSDISSAMANGNWEEAKELAQCAKRDWNRLKNHPSLRCHEDLPLFLRCFTVGWIYTRILSRFVEILQRLHMYEEAVRELESLLSQRIYCPDSRGRWWDRLALNLHQHLKRLEPTIKCITEGLADPEVRTGHRLSLYQRAVRLRESPSCKKFKHLFQQLPEMAVQDVKHVTITGRLCSVEELALAHYRRSGFDQGIHGEGSTFSTLYGLLLWDIIFMDGIPDVFRNACQAFPLDLCTDSFFTSRRPALEARLQLIHDAPEESLRAWVAATWHEQEGRVASLVSWDRFTSLQQAQDLVSCLGGPVLSGVCRHLAADFRHCRGGLPALVVWNSQSRHFKLVEVKGPNDRLSHKQMIWLAELQKLGAEVEVCHVVAV 1009
                                   380       390       400       410       420       430       440       450       460       470       480       490       500     ||519       529       539       549       559 |||   581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781    || 816       826       836       846       856       866       876       886       896       906       916       926       936       946       956       966       976       986       996      1006   
                                                                                                                                                                 506|                                          561||                                                                                                                                                                                                                786|                                                                                                                                                                                                     
                                                                                                                                                                  516                                           569|                                                                                                                                                                                                                 812                                                                                                                                                                                                     
                                                                                                                                                                                                                 575                                                                                                                                                                                                                                                                                                                                                                                                                         

Chain B from PDB  Type:DNA  Length:40
                                                                         
                4rec B   11 CGTTGCTACGCGTGGCGAGCCGTAGCAACGGCTCGCCACG  332
                                    20|      110|      322       332
                                    20|      110|                   
                                    101       313                   

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4REC)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4REC)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4REC)

(-) Gene Ontology  (24, 24)

Asymmetric Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    IOD  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Lys A:516 - Pro A:517   [ RasMol ]  
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4rec
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FAN1_HUMAN | Q9Y2M0
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.21.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.1.4.1
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  FAN1_HUMAN | Q9Y2M0
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FAN1_HUMAN | Q9Y2M04rea 4reb 4ri8 4ri9 4ria 4rib 4ric 4rid 4ry3

(-) Related Entries Specified in the PDB File

4rea 4reb