Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF PAFAN1 - 5' FLAP DNA COMPLEX
 
Authors :  Y. Cho, G. H. Gwon, Y. R. Kim
Date :  30 Aug 14  (Deposition) - 29 Oct 14  (Release) - 29 Oct 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.20
Chains :  Asym. Unit :  A,B,C,D,F,G,H,I
Biol. Unit 1:  A,B,C,D  (1x)
Biol. Unit 2:  F,G,H,I  (1x)
Keywords :  Dna Binding, Metal Binding Nuclease, 5'Flap Dna Endo Nuclease, Fanconi Anemia Proteins Family, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  G. H. Gwon, Y. R. Kim, Y. Liu, A. T. Watson, A. Jo, T. J. Etheridge, F. Yuan Y. Zhang, Y. C. Kim, A. M. Carr, Y. Cho
Crystal Structure Of A Fanconi Anemia-Associated Nuclease Homolog Bound To 5' Flap Dna: Basis Of Interstrand Cross-Link Repair By Fan1
Genes Dev. V. 28 2276 2014
PubMed-ID: 25319828  |  Reference-DOI: 10.1101/GAD.248492.114

(-) Compounds

Molecule 1 - UNCHARACTERIZED PROTEIN
    ChainsA, F
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GenePA1865
    Organism ScientificPSEUDOMONAS AERUGINOSA
    Organism Taxid208964
    StrainPAO1
    SynonymNUCLEASE
 
Molecule 2 - DNA (5'-D(P*AP*CP*CP*AP*GP*AP*CP*AP*CP*AP*CP*AP*TP*TP*C)- 3')
    ChainsB, G
    EngineeredYES
    Other DetailsSYNTHETIC DNA
    SyntheticYES
 
Molecule 3 - DNA (5'-D(P*GP*TP*TP*GP*GP*GP*AP*TP*TP*G)-3')
    ChainsC, H
    EngineeredYES
    Other DetailsSYNTHETIC DNA
    SyntheticYES
 
Molecule 4 - DNA (5'- D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*A)- 3')
    ChainsD, I
    EngineeredYES
    Other DetailsSYNTHETIC DNA
    SyntheticYES

 Structural Features

(-) Chains, Units

  12345678
Asymmetric Unit ABCDFGHI
Biological Unit 1 (1x)ABCD    
Biological Unit 2 (1x)    FGHI

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 4R8A)

(-) Sites  (0, 0)

(no "Site" information available for 4R8A)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4R8A)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4R8A)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4R8A)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4R8A)

(-) Exons   (0, 0)

(no "Exon" information available for 4R8A)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:538
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhh.hhhhhhhhhhhhhh...eee.hhh......hhhhhhhhhhhh..ee...eehhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhh......eehhhhh......eeee.hhhhhhhhhhhhh......hhhhhhhhh..................hhhhhhhhhhhhhhhhhhh...hhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh.............eeee..........hhhhhhhhhh.....eeee..hhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhh.....hhhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhhhhhhh..........eeeee....eeeeeeee......hhhhhhhhhhhhhh...eeeee. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4r8a A  16 LPEPFYYLHNFRAVLAWIGERYADLLDDQERAFIAAFAELPEASQALLVRMVMRKGTLFREGKLAYAEIGDTRAAVQPLLALGWVDAQPTLELAQLFGLLKKDELSQLFRDHLGRANLRKDALLERLQPLFPEARRLAEWQADFAEPVYELRCMALCDRLRLMYFGNLWQDWSEFVLADLGIYRYESVEFSADSRGFRLRADVDAYLHLFDCRQRFDLGEPLEELLAGLPGEPYANPWLEGRRVKLLFQFAQHCEKQRDFDLAQRLYRQSSHPGARLRAIRSLERGERFAEAHALAREASCAPESDAERQGLARLLPRLQGKLGLPRQARAAAPEIDRLDLCLAFPSEPCSVEWAVREHLEEPGCAVHYVENGLINSLFGLLCWEAIFAAIPGAFFHPFHSAPADLHSADFRQRRAALFEACLGRLEDGSYRDAIRCRYRDKFGLQSPFVYWELLGEELLEQALDCLPAAHLRAWFERLLEDIPGNRAGLPDLIQFWPAQRRYRMVEVKGPGDRLQDNQLRWLQFCREREMPVAVCYV 553
                                    25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345       355       365       375       385       395       405       415       425       435       445       455       465       475       485       495       505       515       525       535       545        

Chain B from PDB  Type:DNA  Length:15
                                               
                 4r8a B  -2 ACCAGACACACATTC  12
                                     7     

Chain C from PDB  Type:DNA  Length:10
                                          
                 4r8a C   1 GTTGGGATTG  10
                                    10

Chain D from PDB  Type:DNA  Length:21
                                                     
                 4r8a D   1 GAATGTGTGTCTCAATCCCAA  21
                                    10        20 

Chain F from PDB  Type:PROTEIN  Length:538
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhh.hhhhhhhhhhhhhh...eee.hhh......hhhhhhhhhhhh..ee...eehhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhh......eehhhhh......eeee.hhhhhhhhhhhhh......hhhhhhhhh..................hhhhhhhhhhhhhhhhhhh...hhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh.............eeee..........hhhhhhhhhh.....eeee..hhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhh.....hhhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhhhhhhh..........eeeee....eeeeeeee......hhhhhhhhhhhhhh...eeeee. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4r8a F  16 LPEPFYYLHNFRAVLAWIGERYADLLDDQERAFIAAFAELPEASQALLVRMVMRKGTLFREGKLAYAEIGDTRAAVQPLLALGWVDAQPTLELAQLFGLLKKDELSQLFRDHLGRANLRKDALLERLQPLFPEARRLAEWQADFAEPVYELRCMALCDRLRLMYFGNLWQDWSEFVLADLGIYRYESVEFSADSRGFRLRADVDAYLHLFDCRQRFDLGEPLEELLAGLPGEPYANPWLEGRRVKLLFQFAQHCEKQRDFDLAQRLYRQSSHPGARLRAIRSLERGERFAEAHALAREASCAPESDAERQGLARLLPRLQGKLGLPRQARAAAPEIDRLDLCLAFPSEPCSVEWAVREHLEEPGCAVHYVENGLINSLFGLLCWEAIFAAIPGAFFHPFHSAPADLHSADFRQRRAALFEACLGRLEDGSYRDAIRCRYRDKFGLQSPFVYWELLGEELLEQALDCLPAAHLRAWFERLLEDIPGNRAGLPDLIQFWPAQRRYRMVEVKGPGDRLQDNQLRWLQFCREREMPVAVCYV 553
                                    25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345       355       365       375       385       395       405       415       425       435       445       455       465       475       485       495       505       515       525       535       545        

Chain G from PDB  Type:DNA  Length:15
                                               
                 4r8a G  -2 ACCAGACACACATTC  12
                                     7     

Chain H from PDB  Type:DNA  Length:10
                                          
                 4r8a H   1 GTTGGGATTG  10
                                    10

Chain I from PDB  Type:DNA  Length:21
                                                     
                 4r8a I   1 GAATGTGTGTCTCAATCCCAA  21
                                    10        20 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4R8A)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4R8A)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4R8A)

(-) Gene Ontology  (16, 16)

Asymmetric Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 4r8a)
 
  Sites
(no "Sites" information available for 4r8a)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4r8a)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4r8a
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FAN1_PSEAE | Q9I2N0
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  FAN1_PSEAE | Q9I2N0
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FAN1_PSEAE | Q9I2N04r89

(-) Related Entries Specified in the PDB File

4r89