Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
(-)Biological Unit 3
(-)Biological Unit 4
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)
Image Biological Unit 3
Biological Unit 3  (Jmol Viewer)
Image Biological Unit 4
Biological Unit 4  (Jmol Viewer)

(-) Description

Authors :  I. Birukou, R. G. Brennan
Date :  09 Jul 13  (Deposition) - 14 May 14  (Release) - 14 May 14  (Revision)
Resolution :  3.04
Chains :  Asym. Unit :  A,B,C,D,E,F,G,H,I,J,K,L,M,O
Biol. Unit 1:  A,B,G,H  (1x)
Biol. Unit 2:  C,D,E,F  (1x)
Biol. Unit 3:  I,J,K,L  (1x)
Biol. Unit 4:  M,O  (1x)
Keywords :  Multidrug Resistance, Winged Helix-Turn-Helix, Transcription Repression, Mepr Operator, Transcription-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  I. Birukou, S. M. Seo, B. D. Schindler, G. W. Kaatz, R. G. Brennan
Structural Mechanism Of Transcription Regulation Of The Staphylococcus Aureus Multidrug Efflux Operon Mepra By The Marr Family Repressor Mepr.
Nucleic Acids Res. V. 42 2774 2014
PubMed-ID: 24293644  |  Reference-DOI: 10.1093/NAR/GKT1215

(-) Compounds

Molecule 1 - MEPR
    ChainsA, B, C, D, I, J, M, O
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificSTAPHYLOCOCCUS AUREUS
    Organism Taxid1280
    ChainsE, F, G, H, K, L

 Structural Features

(-) Chains, Units

Biological Unit 1 (1x)AB    GH      
Biological Unit 2 (1x)  CDEF        
Biological Unit 3 (1x)        IJKL  
Biological Unit 4 (1x)            MO

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 4LLL)

(-) Sites  (0, 0)

(no "Site" information available for 4LLL)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4LLL)

(-) Cis Peptide Bonds  (3, 3)

Asymmetric Unit
1Asp A:46 -Gly A:47
2Asp C:46 -Gly C:47
3Asp I:46 -Gly I:47

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4LLL)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4LLL)

(-) Exons   (0, 0)

(no "Exon" information available for 4LLL)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:138
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131        

Chain B from PDB  Type:PROTEIN  Length:138
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131        

Chain C from PDB  Type:PROTEIN  Length:138
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131        

Chain D from PDB  Type:PROTEIN  Length:137
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh....hhhhhhhhhh.hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       

Chain E from PDB  Type:DNA  Length:24
                 4lll E   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain F from PDB  Type:DNA  Length:24
                 4lll F   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain G from PDB  Type:DNA  Length:24
                 4lll G   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain H from PDB  Type:DNA  Length:24
                 4lll H   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain I from PDB  Type:PROTEIN  Length:137
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       

Chain J from PDB  Type:PROTEIN  Length:138
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131        

Chain K from PDB  Type:DNA  Length:24
                 4lll K   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain L from PDB  Type:DNA  Length:24
                 4lll L   1 ATTTAGTTAGATATCTAACTAAAT  24
                                    10        20    

Chain M from PDB  Type:PROTEIN  Length:124
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhh......hhhhhhhhhh.hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------- Transcript
                                    15        25        35        45        55        65        75        85        95       105       125       135    

Chain O from PDB  Type:PROTEIN  Length:135
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh..eeeee.......eeeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    14        24        34        44        54        64        74        84        94       104       114       124       134     

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4LLL)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4LLL)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4LLL)

(-) Gene Ontology  (4, 4)

Asymmetric Unit(hide GO term definitions)


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 4lll)
(no "Sites" information available for 4lll)
  Cis Peptide Bonds
    Asp A:46 - Gly A:47   [ RasMol ]  
    Asp C:46 - Gly C:47   [ RasMol ]  
    Asp I:46 - Gly I:47   [ RasMol ]  
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]
    Biological Unit 3  [ Jena3D ]
    Biological Unit 4  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  Q5Y812_STAAU | Q5Y812
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/TrEMBL
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  Q5Y812_STAAU | Q5Y812
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        Q5Y812_STAAU | Q5Y8125f6f 5ffx
        Q5Y812_STAAU | Q5Y8124l9j 4l9n 4l9t 4l9v 4ld5 4lln 5fb2 5ffz

(-) Related Entries Specified in the PDB File
