Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  DAMAGED DNA INDUCED UV-DAMAGED DNA-BINDING PROTEIN (UV-DDB) DIMERIZATION AND ITS ROLES IN CHROMATINIZED DNA REPAIR
 
Authors :  J. I. Yeh, S. Du
Date :  15 Mar 12  (Deposition) - 22 Aug 12  (Release) - 24 Oct 12  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.22
Chains :  Asym./Biol. Unit :  A,B,F,G
Keywords :  Beta Barrel, Protein-Dna Complex, Double Helix, Damage, Dna Repair, Host-Virus Interactions, Protein Ubiquitination, Proteosomal Degradation, , Dna Binding Protein-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  J. I. Yeh, A. S. Levine, S. Du, U. Chinte, H. Ghodke, H. Wang, H. Shi, C. L. Hsieh, J. F. Conway, B. Van Houten, V. Rapic-Otrin
Damaged Dna Induced Uv-Damaged Dna-Binding Protein (Uv-Ddb) Dimerization And Its Roles In Chromatinized Dna Repair.
Proc. Natl. Acad. Sci. Usa V. 109 E2737 2012
PubMed-ID: 22822215  |  Reference-DOI: 10.1073/PNAS.1110067109

(-) Compounds

Molecule 1 - DNA DAMAGE-BINDING PROTEIN 1
    ChainsA
    EngineeredYES
    Expression SystemSPODOPTERA FRUGIPERDA
    Expression System Cell LineSF9
    Expression System CommonFALL ARMYWORM
    Expression System PlasmidPBLUEBAC4.5/V5-HIS NT-HIS10- DDB1PBLUEBAC4.5/V5-HIS NT-HIS10-DDB1
    Expression System Taxid7108
    Expression System Vector TypePLASMID
    GeneDDB1, DDB1_HUMAN, Q16531, XAP1
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymDDB P127 SUBUNIT, DNA DAMAGE-BINDING PROTEIN A, DDBA, DAMAGE-SPECIFIC DNA-BINDING PROTEIN 1, HBV X-ASSOCIATED PROTEIN 1, XAP-1, UV-DAMAGED DNA-BINDING FACTOR, UV-DAMAGED DNA-BINDING PROTEIN 1, UV-DDB 1, XPE-BINDING FACTOR, XPE-BF, XERODERMA PIGMENTOSUM GROUP E-COMPLEMENTING PROTEIN, XPCE
 
Molecule 2 - DNA DAMAGE-BINDING PROTEIN 2
    ChainsB
    EngineeredYES
    Expression SystemSPODOPTERA FRUGIPERDA
    Expression System Cell LineSF9
    Expression System CommonFALL ARMYWORM
    Expression System PlasmidPBLUEBAC4.5/V5-HISNT-FLAG-DDB2
    Expression System Taxid7108
    Expression System Vector TypePLASMID
    GeneDDB2
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymDDB P48 SUBUNIT, DDBB, DAMAGE-SPECIFIC DNA-BINDING PROTEIN 2, UV-DAMAGED DNA-BINDING PROTEIN 2, UV-DDB 2
 
Molecule 3 - AP24 DNA STRAND
    ChainsF
    EngineeredYES
    Other DetailsSYNTHETIC SINGLE STRANDED 24-OLIGODEOXYNUCLEOTIDES WITH COMPLEMENTARY STRAND SEQUENCE: 5-TGACTGTATGATGACGATGCTGAC-3
    SyntheticYES
 
Molecule 4 - AP24 DNA COMPLEMENTARY STRAND
    ChainsG
    EngineeredYES
    Other DetailsSYNTHETIC SINGLE STRANDED OLIGODEOXYNUCLEOTIDES WITH A CENTRAL TETRAHYDROFURAN ABASIC SITE MIMIC (3DR) ON CODING STRAND WITH SEQUENCE: 5-GTCAGCATCG(3DR)CATCATACAGTCA-3
    SyntheticYES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit ABFG

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric/Biological Unit (1, 1)
No.NameCountTypeFull Name
13DR1Mod. Nucleotide1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE

(-) Sites  (0, 0)

(no "Site" information available for 4E5Z)

(-) SS Bonds  (1, 1)

Asymmetric/Biological Unit
No.Residues
1A:18 -A:313

(-) Cis Peptide Bonds  (16, 16)

Asymmetric/Biological Unit
No.Residues
1Asp A:148 -Asn A:149
2Glu A:224 -Pro A:225
3Gly A:357 -Pro A:358
4Ser A:549 -Asn A:550
5Asn A:550 -Gly A:551
6Leu A:571 -Pro A:572
7Ser A:768 -Lys A:769
8Phe A:771 -Ser A:772
9Asn A:1016 -Leu A:1017
10Gly A:1018 -Glu A:1019
11Thr A:1020 -Ser A:1021
12Ile A:1062 -Lys A:1063
13Glu B:31 -Pro B:32
14Arg B:47 -Cys B:48
15Leu B:53 -Trp B:54
16Pro B:366 -Tyr B:367

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4E5Z)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4E5Z)

(-) Exons   (0, 0)

(no "Exon" information available for 4E5Z)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:1140
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ...eeeeeee......eeeee........eeeeee..eeeeeeee..eeeeeeeee....eeeeeee........eeeeee...eeeeeeeeee..eeeeeeeeeee.............eee......eeeee......eeee...................eeeeee.......eeeeeeee..eeeeeeeeee....eeee.............eeee.......eeee....eeee....eeee.........eee.........eeeeee...eeeeeeeee.........eeeee....ee.....eeee....eeeee.....eeeeee..........eeeeeee.........ee...........eeee.hhhh.eeeeeee..............eeeeeee.........eeeeeee...eeee.........................ee...eeee.....eeee.........ee..................................................ee............eeee........eeee....................ee..ee..ee..ee......eeeeeee....eeeeeeee.............................eeee..eeee..........eeeeee..eeeeeee................eeeeeee...eeeeeeeehhh.eeeeeeeee.......................ee.....................eeeeeeeee.....eeeeee....eeeeeeeeee......eeeeeeeee..........eeeeeee......ee...eee...eeeeeee..eeeeee..eeeeeee.....eeeeeee.....eeeeeee..eeeeee...eeeee..........eeeee.....eeeeee....eeeeee...eeeeee........hhh.eeeeeeeee....eeeeee...............eeeeeeee....eeeeee.hhhhhhhhhhhhhhhh.........hhhhhhhee....ee....eeehhhhhh....hhhhhhhhhh............hhhhhhhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                4e5z A    1 HSYNYVVTAQKPTAVNGCVTGHFTSAEDLNLLIAKNTRLEIYVVTAEGLRPVKEVGMYGKIAVMELFRPKGESKDLLFILTAKYNACILEYKQSGESIDIITRAHGNVQDRIGRPSETGIIGIIDPECRMIGLRLYDGLFKVIPLDRDNKELKAFNIRLEELHVIDVKFLYGCQAPTICFVYQDPQGRHVKTYEVSLREKEFNKGPWKQENVEAEASMVIAVPEPFGGAIIIGQESITYHNGDKYLAIAPPIIKQSTIVCHNRVDPNGSRYLLGDMEGRLFMLLLEKEEQMDGTVTLKDLRVELLGETSIAECLTYLDNGVVFVGSRLGDSQLVKLNVDSNEQGSYVVAMETFTNLGPIVDMCVVDLERQGQGQLVTCSGAFKEGSLRIIRNGIGIHEHASIDLPGIKGLWPLRSDPNRETDDTLVLSFVGQTRVLMLNGEEVEETELMGFVDDQQTFFCGNVAHQQLIQITSASVRLVSQEPKALVSEWKEPQAKNISVASCNSSQVVVAVGRALYYLQIHPQELRQISHTEMEHEVACLDITPLGDSNGLSPLCAIGLWTDISARILKLPSFELLHKEMLGGEIIPRSILMTTFESSHYLLCALGDGALFYFGLNIETGLLSDRKKVTLGTQPTVLRTFRSLSTTNVFACSDRPTVIYSSNHKLVFSNVNLKEVNYMCPLNSDGYPDSLALANNSTLTIGTIDEIQKLHIRTVPLYESPRKICYQEVSQCFGVLSSRIEVQDTSGGTTALRPSASTQALSSSVSSSKLFSSSTAPHETSFGEEVEVHNLLIIDQHTFEVLHAHQFLQNEYALSLVSCKLGKDPNTYFIVGTAMVYPEEAEPKQGRIVVFQYSDGKLQTVAEKEVKGAVYSMVEFNGKLLASINSTVRLYEWTTEKELRTECNHYNNIMALYLKTKGDFILVGDLMRSVLLLAYKPMEGNFEEIARDFNPNWMSAVEILDDDNFLGAENAFNLFVCQKDSAATTDEERQHLQEVGLFHLGEFVNVFCHGSLVMQNLGETSTPTQGSVLFGTVNGMIGLVTSLSESWYNLLLDMQNRLNKVIKSVGKIEHSFWRSFHTERKTEPATGFIDGDLIESFLDISRPKMQEVVANLQYDDGSGMKREATADDLIKVVEELTRIH 1140
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860       870       880       890       900       910       920       930       940       950       960       970       980       990      1000      1010      1020      1030      1040      1050      1060      1070      1080      1090      1100      1110      1120      1130      1140

Chain B from PDB  Type:PROTEIN  Length:402
                                                                                                                                                                                                                                                                                                                                                                                                                                                   
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..................hhhhhh...........................hhhhhhhh...hhhhhhhhhh.....hhhhh..eeee......eeeeee......eeeeee....eeeee.......eee........eeeeee......eeeeee....eeeee....eeeeee...........eeee....eeee.......eee..................eeeee...eeeeeeee...ee.................ee.........................eeee.......eeeee...............ee.....eeeee.................eeeee.....eeeee....................eeeee..eeeee... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                4e5z B   20 RNKRSRSPLELEPEAKKLCAKGSGPSRRCDSDCLWVGLAGPQILPPCRSIVRTLHQHKLGRASWPSVQQGLQQSFLHTLDSYRILQKAAPFDRRATSLAWHPTHPSTVAVGSKGGDIMLWNFGIKDKPTFIKGIGAGGSITGLKFNPLNTNQFYASSMEGTTRLQDFKGNILRVFASSDTINIWFCSLDVSASSRMVVTGDNVGNVILLNMDGKELWNLRMHKKKVTHVALNPCCDWFLATASVDQTVKIWDLRQVRGKASFLYSLPHRHPVNAACFSPDGARLLTTDQKSEIRVYSASQWDCPLGLIPHPHRHFQHLTPIKAAWHPRYNLIVVGRYPDPNFKSCTPYELRTIDVFDGNSGKMMCQLYDPESSGISSLNEFNPMGDTLASAMGYHILIWSEQ  421
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       359       369       379       389       399       409       419  

Chain F from PDB  Type:DNA  Length:24
                                                         
                4e5z F    1 TGACTGTATGATGACGATGCTGAC   24
                                    10        20    

Chain G from PDB  Type:DNA  Length:24
                                                         
                4e5z G    1 GTCAGCATCGxCATCATACAGTCA   24
                                    10|       20    
                                     11-3DR         

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4E5Z)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4E5Z)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4E5Z)

(-) Gene Ontology  (46, 67)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    3DR  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
(no "Sites" information available for 4e5z)
 
  Cis Peptide Bonds
    Arg B:47 - Cys B:48   [ RasMol ]  
    Asn A:1016 - Leu A:1017   [ RasMol ]  
    Asn A:550 - Gly A:551   [ RasMol ]  
    Asp A:148 - Asn A:149   [ RasMol ]  
    Glu A:224 - Pro A:225   [ RasMol ]  
    Glu B:31 - Pro B:32   [ RasMol ]  
    Gly A:1018 - Glu A:1019   [ RasMol ]  
    Gly A:357 - Pro A:358   [ RasMol ]  
    Ile A:1062 - Lys A:1063   [ RasMol ]  
    Leu A:571 - Pro A:572   [ RasMol ]  
    Leu B:53 - Trp B:54   [ RasMol ]  
    Phe A:771 - Ser A:772   [ RasMol ]  
    Pro B:366 - Tyr B:367   [ RasMol ]  
    Ser A:549 - Asn A:550   [ RasMol ]  
    Ser A:768 - Lys A:769   [ RasMol ]  
    Thr A:1020 - Ser A:1021   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4e5z
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  DDB1_HUMAN | Q16531
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  DDB2_HUMAN | Q92466
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  DDB1_HUMAN | Q16531
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  DDB2_HUMAN | Q92466
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        DDB1_HUMAN | Q165312b5l 2b5m 2b5n 2hye 3e0c 3ei1 3ei2 3ei3 3ei4 3i7h 3i7k 3i7l 3i7n 3i7o 3i7p 3i89 3i8c 3i8e 4a08 4a09 4a0a 4a0b 4a0k 4a0l 4a11 4ci1 4ci2 4ci3 4e54 4tz4 5fqd 5hxb 5jk7 5v3o
        DDB2_HUMAN | Q924663ei4 3i7l 4e54

(-) Related Entries Specified in the PDB File

4e54 DAMAGED DNA INDUCED UV-DAMAGED DNA-BINDING PROTEIN (UV-DDB) DIMERIZATION AND ITS ROLES IN CHROMATINIZED DNA REPAIR