Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - manually
(-)NMR Structure - model 1
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - manually
NMR Structure - manually  (Jmol Viewer)
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  SOLUTION STRUCTURE OF HIV-1 REV PEPTIDE-RNA APTAMER COMPLEX
 
Authors :  X. Ye, A. A. Gorin, R. Frederick, W. Hu, A. Majumdar, W. Xu, G. Mclendon, A. Ellington, D. J. Patel
Date :  02 Aug 99  (Deposition) - 14 Oct 99  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A,B  (22x)
Keywords :  Hiv-1 Rev Peptide; Rna Aptamer; Bound Peptide Secondary Structure, Peptide- Binding Rna, Tertiary Architectures, Adaptive-Binding, Rna Binding Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  X. Ye, A. Gorin, R. Frederick, W. Hu, A. Majumdar, W. Xu, G. Mclendon, A. Ellington, D. J. Patel
Rna Architecture Dictates The Conformations Of A Bound Peptide.
Chem. Biol. V. 6 657 1999
PubMed-ID: 10467126  |  Reference-DOI: 10.1016/S1074-5521(99)80117-3
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - BASIC REV PEPTIDE
    ChainsA
    EngineeredYES
    FragmentRESIDUES 34-50
    Other DetailsSEQUENCE FROM REV PROTEIN OF HUMAN IMMUNODEFICIENCY VIRUS TYPE 1
    SyntheticYES
 
Molecule 2 - RNA APTAMER
    ChainsB
    EngineeredYES
    SyntheticYES

 Structural Features

(-) Chains, Units

  
NMR Structure (22x)

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 484D)

(-) Sites  (0, 0)

(no "Site" information available for 484D)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 484D)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 484D)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 484D)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 484D)

(-) Exons   (0, 0)

(no "Exon" information available for 484D)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:17
 aligned with Q79994_9HIV1 | Q79994 from UniProtKB/TrEMBL  Length:59

    Alignment length:17
                                    43       
          Q79994_9HIV1   34 TRQARRNRRRRWRERQR 50
               SCOP domains d484da_ A:        SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains ----------------- Pfam domains
         Sec.struct. author ................. Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                  484d A 34 TRQARRNRRRRWRERQR 50
                                    43       

Chain A from PDB  Type:PROTEIN  Length:17
 aligned with Q9IQN3_9HIV1 | Q9IQN3 from UniProtKB/TrEMBL  Length:90

    Alignment length:17
                                    17       
          Q9IQN3_9HIV1    8 TRQARRNRRRRWRERQR 24
               SCOP domains d484da_ A:        SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains ----------------- Pfam domains
         Sec.struct. author ................. Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                  484d A 34 TRQARRNRRRRWRERQR 50
                                    43       

Chain B from PDB  Type:RNA  Length:27
                                                          
                  484d B  1 GGUGUCUUGGAGUGCUGAUCGGACACC 27
                                    10        20       

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 1)

NMR Structure
(-)
Class: Peptides (792)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 484D)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 484D)

(-) Gene Ontology  (8, 16)

NMR Structure(hide GO term definitions)
Chain A   (Q9IQN3_9HIV1 | Q9IQN3)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0051028    mRNA transport    The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

Chain A   (Q79994_9HIV1 | Q79994)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0051028    mRNA transport    The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 484d)
 
  Sites
(no "Sites" information available for 484d)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 484d)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  484d
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  Q79994_9HIV1 | Q79994
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/TrEMBL
  Q9IQN3_9HIV1 | Q9IQN3
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  Q79994_9HIV1 | Q79994
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  Q9IQN3_9HIV1 | Q9IQN3
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 484D)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 484D)