Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  D. Watkins, G. B. Koudelka, L. D. Williams
Date :  18 Sep 09  (Deposition) - 19 Jan 10  (Release) - 13 Jul 11  (Revision)
Resolution :  1.67
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Protein-Dna Complex, Dna-Binding, Repressor, Transcription, Transcription Regulation, Transcription Regulator (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  D. Watkins, S. Mohan, G. B. Koudelka, L. D. Williams
Sequence Recognition Of Dna By Protein-Induced Conformational Transitions
J. Mol. Biol. V. 396 1145 2010
PubMed-ID: 20053356  |  Reference-DOI: 10.1016/J.JMB.2009.12.050

(-) Compounds

Molecule 1 - 5'-D(*CP*AP*TP*TP*TP*AP*AP*GP*AP*CP*GP*TP*CP*TP*TP*AP*AP*AP *TP*A)-3'
    Other Details - SourceSYNTHETIC DNA OPERATOR 9C
Molecule 2 - 5'-D(*TP*AP*TP*TP*TP*AP*AP*GP*AP*CP*GP*TP*CP*TP*TP*AP*AP*AP *TP*G)-3'
    Other Details - SourceSYNTHETIC DNA OPERATOR 9C
    ChainsC, D
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPUC18
    Expression System StrainXA90
    Expression System Taxid562
    Expression System Vector TypePLASMID
    Organism CommonBACTERIOPHAGE P22
    Organism ScientificENTEROBACTERIA PHAGE P22
    Organism Taxid10754

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 3JXB)

(-) Sites  (0, 0)

(no "Site" information available for 3JXB)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3JXB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 3JXB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3JXB)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
1HTH_CROC1PS50943 Cro/C1-type HTH domain profile.RPC2_BPP2210-64

(-) Exons   (0, 0)

(no "Exon" information available for 3JXB)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:DNA  Length:20
                  3jxb A  1 CATTTAAGACGTCTTAAATA 20
                                    10        20

Chain B from PDB  Type:DNA  Length:20
                  3jxb B 21 TATTTAAGACGTCTTAAATG 40
                                    30        40

Chain C from PDB  Type:PROTEIN  Length:67
 aligned with RPC2_BPP22 | P69202 from UniProtKB/Swiss-Prot  Length:216

    Alignment length:67
                                    11        21        31        41        51        61       
               SCOP domains d3jxbc_ C: P22 C2 repressor, DNA-binding domain                     SCOP domains
               CATH domains 3jxbC00 C:2-68 lambda repressor-like DNA-binding domains            CATH domains
               Pfam domains ------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------HTH_CROC1  PDB: C:10-64 UniProt: 10-64                 ---- PROSITE
                 Transcript ------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61       

Chain D from PDB  Type:PROTEIN  Length:65
 aligned with RPC2_BPP22 | P69202 from UniProtKB/Swiss-Prot  Length:216

    Alignment length:65
                                    13        23        33        43        53        63     
               SCOP domains d3jxbd_ D: P22 C2 repressor, DNA-binding domain                   SCOP domains
               CATH domains 3jxbD00 D:4-68 lambda repressor-like DNA-binding domains          CATH domains
           Pfam domains (1) ------HTH_3-3jxbD01 D:10-64                                  ---- Pfam domains (1)
           Pfam domains (2) ------HTH_3-3jxbD02 D:10-64                                  ---- Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhh.....hhhhhhhhhhhh..hhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------HTH_CROC1  PDB: D:10-64 UniProt: 10-64                 ---- PROSITE
                 Transcript ----------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63     

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 2)

Asymmetric/Biological Unit
Clan: HTH (544)

(-) Gene Ontology  (4, 4)

Asymmetric/Biological Unit(hide GO term definitions)
Chain C,D   (RPC2_BPP22 | P69202)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
biological process
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 3jxb)
(no "Sites" information available for 3jxb)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 3jxb)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  RPC2_BPP22 | P69202
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  RPC2_BPP22 | P69202
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        RPC2_BPP22 | P692021adr 1qar 2r1j 3jxc 3jxd

(-) Related Entries Specified in the PDB File