Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  S. Stella, D. Cascio, R. C. Johnson
Date :  08 Sep 09  (Deposition) - 28 Apr 10  (Release) - 13 Jul 11  (Revision)
Resolution :  3.11
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Protein-Dna Complex, Hth Domain, Minor Groove Compression, Dna Bending, Indirect Recognition, Activator, Dna-Binding, Transcription, Transcription Regulation, Dna Binding Protein-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  S. Stella, D. Cascio, R. C. Johnson
The Shape Of The Dna Minor Groove Directs Binding By The Dna-Bending Protein Fis.
Genes Dev. V. 24 814 2010
PubMed-ID: 20395367  |  Reference-DOI: 10.1101/GAD.1900610

(-) Compounds

    ChainsA, B
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPET11A
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    GeneFIS, B3261, JW3229
    Organism ScientificESCHERICHIA COLI
    Organism Taxid83333
Molecule 2 - DNA (27-MER)
Molecule 3 - DNA (27-MER)

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 3JRA)

(-) Sites  (0, 0)

(no "Site" information available for 3JRA)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3JRA)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 3JRA)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3JRA)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 3JRA)

(-) Exons   (0, 0)

(no "Exon" information available for 3JRA)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:91
 aligned with FIS_ECOLI | P0A6R3 from UniProtKB/Swiss-Prot  Length:98

    Alignment length:91
                                    17        27        37        47        57        67        77        87        97 
               SCOP domains d3jraa_ A: FIS protein                                                                      SCOP domains
               CATH domains 3jraA00 A:8-98 Homeodomain-like                                                             CATH domains
               Pfam domains ------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....eeeee.....eeeeehhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97 

Chain B from PDB  Type:PROTEIN  Length:98
 aligned with FIS_ECOLI | P0A6R3 from UniProtKB/Swiss-Prot  Length:98

    Alignment length:98
                                    10        20        30        40        50        60        70        80        90        
               SCOP domains d3jrab_ B: FIS protein                                                                             SCOP domains
               CATH domains 3jraB00 B:1-98 Homeodomain-like                                                                    CATH domains
           Pfam domains (1) -----------------------------------------------------HTH_8-3jraB01 B:54-95                     --- Pfam domains (1)
           Pfam domains (2) -----------------------------------------------------HTH_8-3jraB02 B:54-95                     --- Pfam domains (2)
         Sec.struct. author .....hhhhh.eeeee.....eeeeehhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90        

Chain C from PDB  Type:DNA  Length:27
                  3jra C  1 AAATTTGGTCATTTCTTAACTAAATTT 27
                                    10        20       

Chain D from PDB  Type:DNA  Length:27
                  3jra D  1 AAATTTAGTTAAGAAATGACCAAATTT 27
                                    10        20       

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 2)

Asymmetric/Biological Unit
Clan: HTH (544)

(-) Gene Ontology  (8, 8)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (FIS_ECOLI | P0A6R3)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0000787    cytoplasmic nucleosome    A complex comprised of DNA wound around a multisubunit core and associated proteins, which forms the primary packing unit of DNA in the cytoplasm into higher order structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 3jra)
(no "Sites" information available for 3jra)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 3jra)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        FIS_ECOLI | P0A6R31etk 1eto 1etq 1etv 1etw 1etx 1ety 1f36 1fia 1fip 3fis 3iv5 3jr9 3jrb 3jrc 3jrd 3jre 3jrf 3jrg 3jrh 3jri 4fis 5ds9 5dtd 5e3l 5e3m 5e3n 5e3o

(-) Related Entries Specified in the PDB File

3iv5 3jr9 3jrb 3jrc 3jrd 3jre 3jrf 3jrg 3jrh 3jri