Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF ADDAB-DNA COMPLEX
 
Authors :  K. Saikrishnan, W. Krajewski, D. Wigley
Date :  07 Oct 11  (Deposition) - 21 Mar 12  (Release) - 18 Apr 12  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.20
Chains :  Asym./Biol. Unit :  A,B,X
Keywords :  Helicase, Nuclease, Dna Repair, Protein-Dna Complex, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  K. Saikrishnan, J. T. Yeeles, N. S. Gilhooly, W. W. Krajewski, M. S. Dillingham, D. B. Wigley
Insights Into Chi Recognition From The Structure Of An Addab-Type Helicase-Nuclease Complex.
Embo J. V. 31 1568 2012
PubMed-ID: 22307084  |  Reference-DOI: 10.1038/EMBOJ.2012.9

(-) Compounds

Molecule 1 - ATP-DEPENDENT HELICASE/NUCLEASE SUBUNIT A
    ChainsA
    EC Number3.1.-.-, 3.6.4.12
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GeneADDA, BSU10630
    MutationYES
    Organism ScientificBACILLUS SUBTILIS
    Organism Taxid1423
    SynonymATP-DEPENDENT HELICASE/NUCLEASE ADDA
 
Molecule 2 - ATP-DEPENDENT HELICASE/DEOXYRIBONUCLEASE SUBUNIT B
    ChainsB
    EC Number3.1.-.-, 3.6.4.12
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GeneADDB, BSU10620
    MutationYES
    Organism ScientificBACILLUS SUBTILIS
    Organism Taxid1423
    SynonymATP-DEPENDENT HELICASE/NUCLEASE ADDB
 
Molecule 3 - DNA (36-MER)
    ChainsX
    EngineeredYES
    SyntheticYES

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit ABX

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric/Biological Unit (1, 1)
No.NameCountTypeFull Name
1SF41Ligand/IonIRON/SULFUR CLUSTER

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)
No.NameEvidenceResiduesDescription
1AC1SOFTWARECYS B:801 , PRO B:1112 , PRO B:1120 , CYS B:1121 , CYS B:1124 , PHE B:1126 , LYS B:1127 , CYS B:1130BINDING SITE FOR RESIDUE SF4 B 1167

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3U44)

(-) Cis Peptide Bonds  (1, 1)

Asymmetric/Biological Unit
No.Residues
1Met B:1115 -Lys B:1116

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3U44)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1UVRD_HELICASE_CTERPS51217 UvrD-like DNA helicase C-terminal domain profile.ADDB_BACSU281-586  1B:281-586
ADDA_BACSU508-798  1A:508-798

(-) Exons   (0, 0)

(no "Exon" information available for 3U44)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:1122
 aligned with ADDA_BACSU | P23478 from UniProtKB/Swiss-Prot  Length:1232

    Alignment length:1223
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       359       369       379       389       399       409       419       429       439       449       459       469       479       489       499       509       519       529       539       549       559       569       579       589       599       609       619       629       639       649       659       669       679       689       699       709       719       729       739       749       759       769       779       789       799       809       819       829       839       849       859       869       879       889       899       909       919       929       939       949       959       969       979       989       999      1009      1019      1029      1039      1049      1059      1069      1079      1089      1099      1109      1119      1129      1139      1149      1159      1169      1179      1189      1199      1209      1219      1229   
          ADDA_BACSU     10 TWTDDQWNAIVSTGQDILVAAAAGSGKTAVLVERMIRKITAEENPIDVDRLLVVTFTNASAAEMKHRIAEALEKELVQRPGSLHIRRQLSLLNRASISTLHSFCLQVLKKYYYLIDLDPGFRIADQTEGELIGDEVLDELFEDEYAKGEKAFFELVDRYTTDRHDLDLQFLVKQVYEYSRSHPNPEAWLESFVHLYDVSEKSAIEELPFYQYVKEDIAMVLNGAKEKLLRALELTKAPGGPAPRADNFLDDLAQIDELIQHQDDFSELYKRVPAVSFKRAKAVKGDEFDPALLDEATDLRNGAKKLLEKLKTDYFTRSPEQHLKSLAEMKPVIETLVQLVISYGKRFEAAKQEKSIIDFSDLEHYCLAILTAENDKGEREPSEAARFYQEQFHEVLVDEYQDTNLVQESILQLVTSGPEETGNLFMVGDVKQSIYRFRLAEPLLFLSKYKRFTESGEGTGRKIDLNKNFRSRADILDSTNFLFKQLMGGKIGEVDYDEQAELKLGAAYPDNDETETELLLIDNAEDTDASEEAEELETVQFEAKAIAKEIRKLISSPFKVYDGKKKTHRNIQYRDIVILLRSMPWAPQIMEELRAQGIPVYANLTSGYFEAVEVAVALSVLKVIDNPYQDIPLASVLRSPIVGADENELSLIRLENKKAPYYEAMKDYLAAGDRSDELYQKLNTFYGHLQKWRAFSKNHSVSELIWEVYRDTKYMDYVGGMPGGKQRQANLRVLYDRARQYESTAFRGLFRFLRFIERMQERGDDLGTARALSEQEDVVRLMTIHSSKGLEFPVVFVAGLGRNFNMMDLNKSYLLDKELGFGTKYIHPQLRISYPTLPLIAMKKKMRRELLSEELRVLYVALTRAKEKLFLIGSCKDHQKQLAKWQASASQTDWLLPEFDRYQARTYLDFIGPALARHRDLGDLAGVPAHADISGHPARFAVQMIHSYDLLDDDLEERMEEKSERLEAIRRGEPVPGSFAFDEKAREQLSWTYPHQEVTQIRTKQSVSEIKRKREYEDEYSGRAPVKPADGSILYRRPAFMMKKGLTAAEKGTAMHTVMQHIPLSHVPSIEEAEQTVHRLYEKELLTEEQKDAIDIEEIVQFFHTEIGGQLIGAKWKDREIPFSLALPAKEIYPDAHEADEPLLVQGIIDCLYETEDGLYLLDYKSDRIEGKFQHGFEGAAPILKKRYETQIQLYTKAVEQIAKTKVKGCALYFFDGGHILTL 1232
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhh....eeeee....hhhhhhhhhhhhhhh......hhh.eeeee.hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhh...eeeehhhhhhhhhhhhhhhh......ee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhh...hhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhhhhhhhhh----------.hhhhhhhhhhhhhhh..hhhhhhhhh....------------.hhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eehhhhhhhhhhhhhh....---...hhhhhhhhhhh.eeee.hhhhhhhhhhhhhhhhh........eeeeehhhhh.......hhhhhhhhhhhh........eeeee.ee...hhhhhhhhhhhhhhhhhhhhhh.........ee...........eeeeee.-------------.hhhhhhhhhhhhhhhhhhhh.....---...........eeeee....hhhhhhhhhhhh...eee........hhhhhhhhhhhhhhhh..hhhhhhhhhh......hhhhhhhhhhhh...hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhh..----------....eeeee.hhh....eeeeee...............eeee...eeeeeeee....eeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhheeeeeeeeee..hhhhhhhhhhhhh.......hhhhhhh...hhhhhhhhhhh..----------.hhhhhh...eeeeee....-------------.hhhhhhh.....---..hhhhhhhhhh....hhhhh....eeee.---------...ee.-----------............hhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeeeeeeee.hhh.........eeeeeeeeeeeee....eeeeeee......----...hhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeee....eeeee Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                PROSITE (2) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UVRD_HELICASE_CTER  PDB: A:508-798 UniProt: 508-798                                                                                                                                                                                                                                                -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE (2)
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3u44 A   10 TWTDDQWNAIVSTGQDILVAAAAGSGKTAVLVERMIRKITAEENPIDVDRLLVVTFTNASAAEMKHRIAEALEKELVQRPGSLHIRRQLSLLNRASISTLHSFCLQVLKKYYYLIDLDPGFRIADQTEGELIGDEVLDELFEDEYAKGEKAFFELVDRYTTDRHDLDLQFLVKQVYEYSRSHPNPEAWLESFVHLYDVSEKSAIEELPFYQYVKEDIAMVLNGAKEKLLRALELT----------DNFLDDLAQIDELIQHQDDFSELYKRVPAVS------------DPALLDEATDLRNGAKKLLEKLKTDYFTRSPEQHLKSLAEMKPVIETLVQLVISYGKRFEAAKQEKSIIDFSDLEHYCLAILTAEND---REPSEAARFYQEQFHEVLVDEYQDTNLVQESILQLVTSGPEETGNLFMVGDVKQSIYRFRLAEPLLFLSKYKRFTESGEGTGRKIDLNKNFRSRADILDSTNFLFKQLMGGKIGEVDYDEQAELKLGAAYPDNDETETELLLID-------------LETVQFEAKAIAKEIRKLISSPFKVY---KKTHRNIQYRDIVILLRSMPWAPQIMEELRAQGIPVYANLTSGYFEAVEVAVALSVLKVIDNPYQDIPLASVLRSPIVGADENELSLIRLENKKAPYYEAMKDYLAAGDRSDELYQKLNTFYGHLQKWRAFSKNHSVSELIWEVYRDTKYMDYVGGMPGGKQRQANLRVLYDRARQYESTAFRGLFRFLRFIERMQERGD----------QEDVVRLMTIHSSKGLEFPVVFVAGLGRNFNMMDLNKSYLLDKELGFGTKYIHPQLRISYPTLPLIAMKKKMRRELLSEELRVLYVALTRAKEKLFLIGSCKDHQKQLAKWQASASQTDWLLPEFDRYQARTYLDFIGPALARHR----------HADISGHPARFAVQMIHSYD-------------SERLEAIRRGEPV---FAFDEKAREQLSWTYPHQEVTQIRTKQSVS---------DEYSGR-----------YRRPAFMMKKGLTAAEKGTAMHTVMQHIPLSHVPSIEEAEQTVHRLYEKELLTEEQKDAIDIEEIVQFFHTEIGGQLIGAKWKDREIPFSLALPAKEIYPDAHEADEPLLVQGIIDCLYETEDGLYLLAYKSDRIEG----GFEGAAPILKKRYETQIQLYTKAVEQIAKTKVKGCALYFFDGGHILTL 1232
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239    |    -     | 259       269       279     |   -       299       309       319       329       339       349       359       369       379    |  389       399       409       419       429       439       449       459       469       479       489       499       509       519       529 |       -     | 549       559       569|   |  579       589       599       609       619       629       639       649       659       669       679       689       699       709       719       729       739       749       759       769   |     -    |  789       799       809       819       829       839       849       859       869       879       889       899       909       919        |-       939       949        |-         -  |    979    |  989       999      1009       | -      1029  |      -    | 1049      1059      1069      1079      1089      1099      1109      1119      1129      1139      1149      1159      1169      1179|    |1189      1199      1209      1219      1229   
                                                                                                                                                                                                                                                                    244        255                           285          298                                                                                   384 388                                                                                                                                            531           545                      570 574                                                                                                                                                                                                    773        784                                                                                                                                             928        939                958           972         984 988                         1017      1027 1032        1044                                                                                                                                    1180 1185                                               

Chain B from PDB  Type:PROTEIN  Length:1141
 aligned with ADDB_BACSU | P23477 from UniProtKB/Swiss-Prot  Length:1166

    Alignment length:1159
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111      1121      1131      1141      1151         
          ADDB_BACSU      2 GAEFLVGRSGSGKTKLIINSIQDELRRAPFGKPIIFLVPDQMTFLMEYELAKTPDMGGMIRAQVFSFSRLAWRVLQHTGGMSRPFLTSTGVQMLLRKLIEEHKQEFKVYQKASDKSGFTAQVERMLTEFKRYCLEPEDIRRMAESGTASEYRGERVLSEKLHDLSILYQQMEKSLADQYLHSEDYLTLLAEHIPLAEDIKGAHIYVDGFYQFTPQEFRVLEQLMVHAEHITFSLTADKPSYEREPHELELFRMTGKTYYRLHQKAKELNLDITYKELSGTERHTKTPELAHLEAQYEARPAIPYAEKQEALTVMQAANRRAELEGIAREIHALVREKGYRYKDVAILARQPEDYKDMVKEVFADYEIPYFIDGKASMLNHPLIEFIRSSLDVLKGNWRYEAVFRCVKTELLFPLNEPKAKVREQVDQLENYCIAYGIKGDRWTKGDRFQYRRFVSLDDDFAQTDQEIEMENMLNDTRDWIVPPLFQLQKRMKKAKTVQEKAEALYRYLEETDVPLKLDQERQRAEDDGRIIEAQQHQQAWDAVIQLLEEFVEMMGDDEISLDLFQQMIEAGAESLTFSLIPPALDQVFVGNMDLSRMYGTSCTFVLGANDGVLPARPDENGVLSDDDREWLKTIGVELSSGGRERLLDEHFLIYMAFSSPSDRLYVSYPIADAEGKTLLPSMIVKRLEELFPHHKERLLTNEPEQVSDEEQLMYVVNKSVAQSFTASQLRLWTREYDISDVWWSTYNVLMSEQDRLQSKKLFSSLFFRNEVKQLERSVSRQLYGERIQGSVSRMETFNACPFSHFASHGLHLKERQFFKLEAPDIGQLFHSSLKLISDRLREQKLDWRDLTKEQCELFSYDAVERLAPKLQKEILLSSNRHYYVKEKLQKIVTRVSGILSEHAKASGFVPIGLELGFGGKGPLPPLTFQLKNGCTMELVGRIDRVDKAESSKGLLLRIVDYKSSDKGLDLAEVYYGLALQMLTYLDLSITHSADWLGMRATPAGVLYFHIHDPMIQSNLPLGLDEIEQEIFKKFKMKGLLLGDQEVVRLMDTTLQEGRSNIINAGLKKDGSLRSDSAAVGEKEFDLLTKHVRRTFQEAGEQITDGRVSIEPYKMKNKTPCTYCAFKSVCQFDESLEENEYRPLKAEKDKTILEWIKKEA 1160
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeee....hhhhhhhhhhhhhhhhh.....eeee.hhhhhhhhhhhhh......ee..eeeehhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhh..hhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhh.........eeee......hhhhhhhhhhhhhhh.eeeeeee...............hhhhhhhhhhhhhhhhhh...eeeeee........hhhhhhhhhhh..............eeeeee.hhhhhhhhhhhhhhhhhhh...hhh.eeeee.hhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhhhhhh..hhhhhhhhhh.........hhhhhhhhhhhhhhhhhhh...hhhhhh------------------.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh...........eeeee..........eeeee.................hhhhhhhhhh.........hhhhhhhhhhhhhhhh....eeeeeee...........hhhhhhhhhhh....eeee..hhhhhhhhhhh....hhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhh.....hhhhhhhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eeeeeeeee........eeeee...eeeee.eeeeeeeeeee..eeeeeeeeee......hhhhhhh...hhhhhhhhhhhhhhhhhhh...eeeeeeeee.....ee.....hhhhhhhhhhhh...eeeee.hhhhhhhhh.....ee......ee...........eehhhhhhhhhhhhhhhhhhhhhhhhh.......ee...........hhhhhh..........ee....hhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UVRD_HELICASE_CTER  PDB: B:281-586 UniProt: 281-586                                                                                                                                                                                                                                                               ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3u44 B    2 GAEFLVGRSGSGKTKLIINSIQDELRRAPFGKPIIFLVPDQMTFLMEYELAKTPDMGGMIRAQVFSFSRLAWRVLQHTGGMSRPFLTSTGVQMLLRKLIEEHKQEFKVYQKASDKSGFTAQVERMLTEFKRYCLEPEDIRRMAESGTASEYRGERVLSEKLHDLSILYQQMEKSLADQYLHSEDYLTLLAEHIPLAEDIKGAHIYVDGFYQFTPQEFRVLEQLMVHAEHITFSLTADKPSYEREPHELELFRMTGKTYYRLHQKAKELNLDITYKELSGTERHTKTPELAHLEAQYEARPAIPYAEKQEALTVMQAANRRAELEGIAREIHALVREKGYRYKDVAILARQPEDYKDMVKEVFADYEIPYFIDGKASMLNHPLIEFIRSSLDVLKGNWRYEAVFRCVKTELLFPLNEPKAKVREQVDQLENYCIAYGIKGDRWTK------------------TDQEIEMENMLNDTRDWIVPPLFQLQKRMKKAKTVQEKAEALYRYLEETDVPLKLDQERQRAEDDGRIIEAQQHQQAWDAVIQLLEEFVEMMGDDEISLDLFQQMIEAGAESLTFSLIPPALDQVFVGNMDLSRMYGTSCTFVLGANDGVLPARPDENGVLSDDDREWLKTIGVELSSGGRERLLDEHFLIYMAFSSPSDRLYVSYPIADAEGKTLLPSMIVKRLEELFPHHKERLLTNEPEQVSDEEQLMYVVNKSVAQSFTASQLRLWTREYDISDVWWSTYNVLMSEQDRLQSKKLFSSLFFRNEVKQLERSVSRQLYGERIQGSVSRMETFNACPFSHFASHGLHLKERQFFKLEAPDIGQLFHSSLKLISDRLRDEKLDWRDLTKEQCELFSYDAVERLAPKLQKEILLSSNRHYYVKEKLQKIVTRVSGILSEHAKASGFVPIGLELGFGGKGPLPPLTFQLKNGCTMELVGRIDRVDKAESSKGLLLRIVAYKSSDKGLDLAEVYYGLALQMLTYLDLSITHSADWLGMRATPAGVLYFHIHDPMIQSNLPLGLDEIEQEIFKKFKMKGLLLGDQEVVRLMDTTLQEGRSNIINAGLKKDGSLRSDSAAVGEKEFDLLTKHVRRTFQEAGEQITDGRVSIEPYKMKNKTPCTYCAFKSVCQFDESLEENEYRPLKAEKDKTILEWIKKEA 1160
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441   |     -         -  |    471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111      1121      1131      1141      1151         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     445                464                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        

Chain X from PDB  Type:DNA  Length:36
                                                                     
                3u44 X    1 TCTAATGCGAGCACTGCAGTGCTCGCATTAGATTTT   47
                                    10     || 31        41      
                                          16|                   
                                           28                   

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3U44)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3U44)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3U44)

(-) Gene Ontology  (21, 33)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (ADDA_BACSU | P23478)
molecular function
    GO:0008408    3'-5' exonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by removing nucleotide residues from the 3' end.
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004003    ATP-dependent DNA helicase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of the DNA helix.
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0004527    exonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by removing nucleotide residues from the 3' or 5' end.
    GO:0004386    helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0032508    DNA duplex unwinding    The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating a region of unpaired single strands.
    GO:0006281    DNA repair    The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.
    GO:0006302    double-strand break repair    The repair of double-strand breaks in DNA via homologous and nonhomologous mechanisms to reform a continuous DNA helix.
    GO:0000724    double-strand break repair via homologous recombination    The error-free repair of a double-strand break in DNA in which the broken DNA molecule is repaired using homologous sequences. A strand in the broken DNA searches for a homologous region in an intact chromosome to serve as the template for DNA synthesis. The restoration of two intact DNA molecules results in the exchange, reciprocal or nonreciprocal, of genetic material between the intact DNA molecule and the broken DNA molecule.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.

Chain B   (ADDB_BACSU | P23477)
molecular function
    GO:0051539    4 iron, 4 sulfur cluster binding    Interacting selectively and non-covalently with a 4 iron, 4 sulfur (4Fe-4S) cluster; this cluster consists of four iron atoms, with the inorganic sulfur atoms found between the irons and acting as bridging ligands.
    GO:0008409    5'-3' exonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by removing nucleotide residues from the 5' end.
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0004527    exonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by removing nucleotide residues from the 3' or 5' end.
    GO:0004386    helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0016788    hydrolase activity, acting on ester bonds    Catalysis of the hydrolysis of any ester bond.
    GO:0051536    iron-sulfur cluster binding    Interacting selectively and non-covalently with an iron-sulfur cluster, a combination of iron and sulfur atoms.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0006281    DNA repair    The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.
    GO:0000724    double-strand break repair via homologous recombination    The error-free repair of a double-strand break in DNA in which the broken DNA molecule is repaired using homologous sequences. A strand in the broken DNA searches for a homologous region in an intact chromosome to serve as the template for DNA synthesis. The restoration of two intact DNA molecules results in the exchange, reciprocal or nonreciprocal, of genetic material between the intact DNA molecule and the broken DNA molecule.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    SF4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Met B:1115 - Lys B:1116   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3u44
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  ADDA_BACSU | P23478
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  ADDB_BACSU | P23477
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.6.4.12
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  ADDA_BACSU | P23478
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  ADDB_BACSU | P23477
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        ADDA_BACSU | P234783u4q 4ceh 4cei 4cej
        ADDB_BACSU | P234773u4q 4ceh 4cei 4cej

(-) Related Entries Specified in the PDB File

3u4q