Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Authors :  K. Das, E. Arnold
Date :  22 Sep 09  (Deposition) - 06 Oct 09  (Release) - 15 Dec 09  (Revision)
Resolution :  3.30
Chains :  Asym./Biol. Unit :  A,B,P,T
Keywords :  Hiv-1 Reverse Transcriptase, Tenofovir, Rt-Dna Complex, Transferase/Dna Complex, Drug Resistance Mutation, Aids, Dna Recombination, Dna-Directed Dna Polymerase, Rnase H, Hydrolase, Lipoprotein, Magnesium, Membrane, Metal-Binding, Multifunctional Enzyme, Nucleotidyltransferase, Rna- Directed Dna Polymerase Transferase (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  K. Das, R. P. Bandwar, K. L. White, J. Y. Feng, S. G. Sarafianos, S. Tuske, X. Tu, A. D. Clark, P. L. Boyer, X. Hou, B. L. Gaffney, R. A. Jones, M. D. Miller, S. H. Hughes, E. Arnold
Structural Basis For The Role Of The K65R Mutation In Hiv-1 Reverse Transcriptase Polymerization, Excision Antagonism, And Tenofovir Resistance.
J. Biol. Chem. V. 284 35092 2009
PubMed-ID: 19812032  |  Reference-DOI: 10.1074/JBC.M109.022525
(for further references see the PDB file header)

(-) Compounds

    EC Number2.7.7.49
    Expression SystemESCHERICHIA COLI
    Expression System StrainDH5ALPHA
    Expression System Taxid562
    GeneGAG-POL, POL
    Organism CommonHIV-1
    Organism Taxid11678
    EC Number2.7.7.49
    Expression SystemESCHERICHIA COLI
    Expression System StrainDH5ALPHA
    Expression System Taxid562
    GeneGAG-POL, POL
    Organism CommonHIV-1
    Organism Taxid11678
Molecule 4 - DNA (5'- D(*A*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*(DDG))-3')

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABPT

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (5, 7)

Asymmetric/Biological Unit (5, 7)
No.NameCountTypeFull Name

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
1AC1SOFTWAREARG A:65 , LYS A:70 , ARG A:72 , ASP A:110 , VAL A:111 , GLY A:112 , ASP A:113 , ALA A:114 , TYR A:115 , GLN A:151 , ASP A:185 , LYS A:219 , MG A:600 , DDG P:823 , DT T:705 , DC T:706BINDING SITE FOR RESIDUE DTP A 700

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3JYT)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric/Biological Unit
1Pro A:225 -Pro A:226
2Pro A:420 -Pro A:421

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (5, 6)

Asymmetric/Biological Unit (5, 6)
No.SourceVariant IDVariantUniProt IDStatusIDChainVariant
1UniProtVAR_POL_HV1B1_003 *K771RPOL_HV1B1  ---  ---A/BK172R
2UniProtVAR_POL_HV1B1_004 *K1050RPOL_HV1B1  ---  ---AK451R
3UniProtVAR_POL_HV1B1_005 *V1057LPOL_HV1B1  ---  ---AV458L
4UniProtVAR_POL_HV1B1_006 *K1111QPOL_HV1B1  ---  ---AK512Q
5UniProtVAR_POL_HV1B1_007 *E1128QPOL_HV1B1  ---  ---AE529Q
   * ID not provided by source

  SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

(-) PROSITE Motifs  (2, 3)

Asymmetric/Biological Unit (2, 3)
1RT_POLPS50878 Reverse transcriptase (RT) catalytic domain profile.POL_HV1B1643-833
2RNASE_HPS50879 RNase H domain profile.POL_HV1B11033-1156  1A:434-554

(-) Exons   (0, 0)

(no "Exon" information available for 3JYT)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:554
 aligned with POL_HV1B1 | P03366 from UniProtKB/Swiss-Prot  Length:1447

    Alignment length:554
                                   609       619       629       639       649       659       669       679       689       699       709       719       729       739       749       759       769       779       789       799       809       819       829       839       849       859       869       879       889       899       909       919       929       939       949       959       969       979       989       999      1009      1019      1029      1039      1049      1059      1069      1079      1089      1099      1109      1119      1129      1139      1149    
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains 3jytA01 A:1-90,A:116-156 HIV Type 1 Reverse Transcriptase, subunit A, domain 1            3jytA02                  3jytA01 A:1-90,A:116-156                 3jytA02 A:91-115,A:157-225  [code=, no name defined]      3jytA03 A:226-319  [code=, no name defined]                                        3jytA04 A:320-426  [code=, no name defined]                                                     3jytA05 A:427-554  [code=3.30.420.10, no name defined]                                                                           CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------RNase_H-3jytA01 A:435-554                                                                                                Pfam domains
         Sec.struct. author ..........................hhhhhhhhhhhhhhhhhh..eee..........eeeeee..eeeeeeee.hhhhhhhh...........hhhhh....eeeeee...hhhhh....hhhhhh.eee.........eeeee........hhhhhhhhhhhhhhhhhhhhh...eeeee..eeeeee..hhhhhhhhhhhhhhhhhhh..............eee..eee....eee...........hh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------R--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------R------L-----------------------------------------------------Q----------------Q------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------RT_POL  PDB: A:44-234 UniProt: 643-833                                                                                                                                                         -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------RNASE_H  PDB: A:434-554 UniProt: 1033-1156                                                                                PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550    

Chain B from PDB  Type:PROTEIN  Length:413
 aligned with POL_HV1B1 | P03366 from UniProtKB/Swiss-Prot  Length:1447

    Alignment length:426
                                   611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains 3jytB01 B:3-93,B:116-156 HIV Type 1 Reverse Transcriptase, subunit A, domain 1             3jytB02               3jytB01 B:3-93,B:116-156                 3jytB02 B:94-115,B:157-237  [code=, no name define             d]     3jytB03 B:238-319  [code=, no name defined]                            3jytB04 B:320-428  [code=, no name defined]                                                        CATH domains
           Pfam domains (1) ------------------------------------------------------------RVT_1-3jytB01 B:63-234                                                                                                                                                      ---RVT_thumb-3jytB05 B:238-307                                           ---------RVT_connect-3jytB03 B:317-419                                                                          --------- Pfam domains (1)
           Pfam domains (2) ------------------------------------------------------------RVT_1-3jytB02 B:63-234                                                                                                                                                      ---RVT_thumb-3jytB06 B:238-307                                           ---------RVT_connect-3jytB04 B:317-419                                                                          --------- Pfam domains (2)
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------R---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -----------------------------------------RT_POL  PDB: B:44-234 UniProt: 643-833                                                                                                                                                         -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       142       152       162       172       182       192       202       212    |    -       232       242       252       262       272       282       292       302       312       322       332       342       352       362       372       382       392       402       412       422      
                                                                                                                                                                                                                                                217           231                                                                                                                                                                                                     

Chain P from PDB  Type:DNA  Length:20
                3jyt P  803 CAGTCCCTGTTCGGgCGCCx  823
                                   812    |  823

Chain T from PDB  Type:DNA  Length:24
                3jyt T  702 TGGTCGGCGCCCGAACAGGGACTG  725
                                   711       721    

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3JYT)

(-) CATH Domains  (3, 9)

Asymmetric/Biological Unit
Class: Alpha Beta (26913)

(-) Pfam Domains  (4, 7)

Asymmetric/Biological Unit
Clan: RNase_H (288)
Clan: RdRP (210)

(-) Gene Ontology  (45, 45)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (POL_HV1B1 | P03366)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003887    DNA-directed DNA polymerase activity    Catalysis of the reaction: deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1); the synthesis of DNA from deoxyribonucleotide triphosphates in the presence of a DNA template and a 3'hydroxyl group.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0004523    RNA-DNA hybrid ribonuclease activity    Catalysis of the endonucleolytic cleavage of RNA in RNA-DNA hybrids to 5'-phosphomonoesters.
    GO:0003964    RNA-directed DNA polymerase activity    Catalysis of the reaction: deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1). Catalyzes RNA-template-directed extension of the 3'- end of a DNA strand by one deoxynucleotide at a time.
    GO:0004190    aspartic-type endopeptidase activity    Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a mechanism in which a water molecule bound by the side chains of aspartic residues at the active center acts as a nucleophile.
    GO:0003824    catalytic activity    Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic.
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
    GO:0004533    exoribonuclease H activity    Catalysis of the exonucleolytic cleavage of RNA to 5'-phosphomonoester oligonucleotides in both 5' to 3' and 3' to 5' directions.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0008289    lipid binding    Interacting selectively and non-covalently with a lipid.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0008233    peptidase activity    Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid.
    GO:0005198    structural molecule activity    The action of a molecule that contributes to the structural integrity of a complex or its assembly within or outside a cell.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
    GO:0008270    zinc ion binding    Interacting selectively and non-covalently with zinc (Zn) ions.
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0090502    RNA phosphodiester bond hydrolysis, endonucleolytic    The chemical reactions and pathways involving the hydrolysis of internal 3',5'-phosphodiester bonds in one or two strands of ribonucleotides.
    GO:0090503    RNA phosphodiester bond hydrolysis, exonucleolytic    The chemical reactions and pathways involving the hydrolysis of terminal 3',5'-phosphodiester bonds in one or two strands of ribonucleotides.
    GO:0006278    RNA-dependent DNA biosynthetic process    A DNA biosynthetic process that uses RNA as a template for RNA-dependent DNA polymerases (e.g. reverse transcriptase) that synthesize the new strand.
    GO:0075713    establishment of integrated proviral latency    A process by which the virus integrates into the host genome and establishes as a stable provirus or prophage.
    GO:0008152    metabolic process    The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation.
    GO:0039526    modulation by virus of host apoptotic process    Any process in which a virus modulates the frequency, rate or extent of apoptosis of infected host cells.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.
    GO:0006508    proteolysis    The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds.
    GO:0039657    suppression by virus of host gene expression    Any process in which a virus stops, prevents, or reduces the frequency, rate or extent of gene expression in the host organism. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Some protein processing events may be included when they are required to form an active form of a product from an inactive precursor form.
    GO:0046718    viral entry into host cell    The process that occurs after viral attachment by which a virus, or viral nucleic acid, breaches the plasma membrane or cell envelope and enters the host cell. The process ends when the viral nucleic acid is released into the host cell cytoplasm.
    GO:0075732    viral penetration into host nucleus    The crossing by the virus of the host nuclear membrane, either as naked viral genome or for small viruses as an intact capsid.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
    GO:0019076    viral release from host cell    The dissemination of mature viral particles from the host cell, e.g. by cell lysis or the budding of virus particles from the cell membrane.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044174    host cell endosome    A membrane-bounded organelle that carries materials newly ingested by endocytosis. It passes many of the materials to host cell lysosomes for degradation.
    GO:0033644    host cell membrane    Double layer of lipid molecules as it encloses host cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins. The host is defined as the larger of the organisms involved in a symbiotic interaction.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.
    GO:0020002    host cell plasma membrane    The plasma membrane surrounding a host cell.
    GO:0072494    host multivesicular body    A late endosome in which regions of the limiting host cell endosomal membrane invaginate to form internal vesicles; host membrane proteins that enter the internal vesicles are sequestered from the host cytoplasm.
    GO:0016020    membrane    A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.
    GO:0019028    viral capsid    The protein coat that surrounds the infective nucleic acid in some virus particles. It comprises numerous regularly arranged subunits, or capsomeres.
    GO:0019013    viral nucleocapsid    The complete protein-nucleic acid complex that is the packaged form of the genome in a virus particle.
    GO:0019012    virion    The complete fully infectious extracellular virus particle.
    GO:0055036    virion membrane    The lipid bilayer surrounding a virion.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    DDG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    DTP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MRG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
    Pro A:225 - Pro A:226   [ RasMol ]  
    Pro A:420 - Pro A:421   [ RasMol ]  

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  POL_HV1B1 | P03366
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  POL_HV1B1 | P03366
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        POL_HV1B1 | P033661a9m 1ajv 1ajx 1axa 1bqm 1bqn 1d4h 1d4i 1d4j 1dlo 1dw6 1ebk 1ebw 1eby 1ebz 1ec0 1ec1 1ec2 1ec3 1eet 1g35 1gnm 1gnn 1gno 1har 1hbv 1hef 1heg 1hih 1hmv 1hni 1hnv 1hos 1hps 1hpz 1hqe 1hqu 1hrh 1hte 1htf 1htg 1hvi 1hvk 1hvp 1hvu 1hys 1ikv 1ikw 1ikx 1iky 1j5o 1kjh 1mer 1mes 1met 1meu 1n5y 1n6q 1npa 1npv 1npw 1qe1 1qmc 1r0a 1rdh 1rtd 1rvl 1rvm 1rvn 1rvo 1rvp 1rvq 1rvr 1s6p 1s6q 1s9e 1s9g 1sbg 1suq 1sv5 1t03 1t05 1t7k 1tv6 1tvr 1uwb 1w5v 1w5w 1w5x 1w5y 1yt9 1zp8 1zpa 1zsf 1zsr 2aqu 2b5j 2b6a 2ban 2bbb 2be2 2exf 2fde 2g69 2hb3 2hmi 2hnz 2hs1 2hs2 2i4d 2i4u 2i4v 2i4w 2i4x 2i5j 2iaj 2ic3 2idw 2ien 2ieo 2jzw 2l45 2l46 2l4l 2uxz 2uy0 2vg5 2vg6 2vg7 2wkz 2wl0 2x4u 2xye 2xyf 2ykm 2ykn 2zd1 2ze2 3avi 3bgr 3dlk 3gga 3ggv 3ggx 3hvt 3ig1 3irx 3is9 3isn 3ith 3jsm 3k2p 3k4v 3kle 3klf 3klg 3klh 3kli 3ndt 3nu3 3nu4 3nu5 3nu6 3nu9 3nuj 3nuo 3ok9 3psu 3qaa 3qlh 3qo9 3tkg 3tkw 3tl9 3tlh 3v4i 3v6d 3v81 3zps 3zpt 3zpu 4coe 4cp7 4cpq 4cpr 4cps 4cpt 4cpu 4cpw 4cpx 4dg1 4g1q 4g8g 4g8i 4g9d 4g9f 4h4m 4h4o 4i2p 4i2q 4icl 4id5 4idk 4ifv 4ify 4ig0 4ig3 4kfb 4kko 4ko0 4lsl 4lsn 4mfb 4o44 4o4g 4ojr 4pqu 4puo 4pwd 4q0b 4qag 4r5p 4rw4 4rw6 4rw7 4rw8 4rw9 4u8w 4we1 4ye3 4yhq 4zip 4zls 5agz 5ah6 5ah7 5ah8 5ah9 5aha 5ahb 5ahc 5bry 5bs4 5c24 5c25 5c42 5cym 5cyq 5d3g 5fdl 5hbm 5hlf 5hp1 5hro 5i3u 5i42 5j1e 5jfp 5jfu 5jg1 5t6z 5t70 5tep 5ter 5tuq 5tw3 5txl 5txm 5txn 5txo 5txp

(-) Related Entries Specified in the PDB File

1rtd 1t05 3jsm