Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  D. R. Ronning, C. Guynet, B. Ton-Hoang, Z. N. Perez, R. Ghirlando, M. Chandler, F. Dyda
Date :  03 Jul 05  (Deposition) - 25 Oct 05  (Release) - 24 Feb 09  (Revision)
Resolution :  2.60
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Rna Recognition Motif, Dna Stem-Loop, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  D. R. Ronning, C. Guynet, B. Ton-Hoang, Z. N. Perez, R. Ghirlando, M. Chandler, F. Dyda
Active Site Sharing And Subterminal Hairpin Recognition In A New Class Of Dna Transposases.
Mol. Cell V. 20 143 2005
PubMed-ID: 16209952  |  Reference-DOI: 10.1016/J.MOLCEL.2005.07.026
(for further references see the PDB file header)

(-) Compounds

    ChainsC, D
Molecule 2 - ISHP608 TRANSPOSASE
    ChainsA, B
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPDR32
    Expression System StrainBL21 (DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    Organism ScientificHELICOBACTER PYLORI
    Organism Taxid210

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 2A6O)

(-) Sites  (0, 0)

(no "Site" information available for 2A6O)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2A6O)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2A6O)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2A6O)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 2A6O)

(-) Exons   (0, 0)

(no "Exon" information available for 2A6O)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:152
 aligned with Q933Z0_HELPX | Q933Z0 from UniProtKB/TrEMBL  Length:155

    Alignment length:152
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153  
               SCOP domains d2a6oa_ A: ISHP608 transposase                                                                                                                           SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153  

Chain B from PDB  Type:PROTEIN  Length:152
 aligned with Q933Z0_HELPX | Q933Z0 from UniProtKB/TrEMBL  Length:155

    Alignment length:152
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153  
               SCOP domains d2a6ob_ B: ISHP608 transposase                                                                                                                           SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153  

Chain C from PDB  Type:DNA  Length:22
                 2a6o C   1 CCCCTAGCTTTAGCTATGGGGA  22
                                    10        20  

Chain D from PDB  Type:DNA  Length:22
                 2a6o D   1 CCCCTAGCTTTAGCTATGGGGA  22
                                    10        20  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 2A6O)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2A6O)

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (Q933Z0_HELPX | Q933Z0)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0004803    transposase activity    Catalysis of the transposition of transposable elements or transposons. Transposases are involved in recombination required for transposition and are site-specific for the transposon/transposable element.
biological process
    GO:0006313    transposition, DNA-mediated    Any process involved in a type of transpositional recombination which occurs via a DNA intermediate.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 2a6o)
(no "Sites" information available for 2a6o)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2a6o)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  Q933Z0_HELPX | Q933Z0
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/TrEMBL
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  Q933Z0_HELPX | Q933Z0
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        Q933Z0_HELPX | Q933Z02a6m 2vhg 2vic 2vih 2vju 2vjv

(-) Related Entries Specified in the PDB File