1ULL - JenaLib

Title :   RNA APTAMER COMPLEXED WITH HIV-1 REV PEPTIDE, NMR, 7 STRUCTURES

Authors :   X. Ye, A. Gorin, A. D. Ellington, D. J. Patel

Date :   05 Nov 96 (Deposition) - 20 Aug 97 (Release) - 24 Feb 09 (Revision)

Method :   SOLUTION NMR

Resolution :   NOT APPLICABLE

Chains :   NMR Structure  : A,B  (7x)

Keywords :   Rev Peptide-Rna Recognition, Alpha-Helix In Widened Rna Major Groove, Purine-Purine Mismatches, Uau Base Triple, Adaptive Binding Of Peptide And Rna In Complex, Complex (Rna Aptamer/Rev Peptide), Viral Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   X. Ye, A. Gorin, A. D. Ellington, D. J. Patel
Deep Penetration Of An Alpha-Helix Into A Widened Rna Major Groove In The Hiv-1 Rev Peptide-Rna Aptamer Complex.
Nat. Struct. Biol. V. 3 1026 1996
PubMed-ID: 8946856 | Reference-DOI: 10.1038/NSB1296-1026
(for further references see the PDB file header)

Compounds

*Molecule 1 - RNA (5'-R (GPGPCPUPGPGPAPCPUPCPGPUPAPCPUPUPCPGP* GPUPAPCPUPGPGPAPGPAPAPAPCPAPGPCPC)-3')**
	Chains	:	A
	Engineered	:	YES
	Other Details	:	17-MER PEPTIDE OF REV PROTEIN FROM HIV-I
	Synthetic	:	YES

Molecule 2 - REV PEPTIDE
	Chains	:	B
	Engineered	:	YES
	Fragment	:	RESIDUES 34 - 50
	Organism Scientific	:	HUMAN IMMUNODEFICIENCY VIRUS 1
	Organism Taxid	:	11676
	Other Details	:	REV PEPTIDE

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

NMR Structure

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:35
                                                                  
                  1ull A  1 GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC 35
                                    10        20        30

Chain B from PDB  Type:PROTEIN  Length:17
 aligned with REV_HV1W2 | P05866 from UniProtKB/Swiss-Prot  Length:90

    Alignment length:17
                                    17       
             REV_HV1W2    8 TRQARRNRRRRWRERQR 24
               SCOP domains d1ullb_ B:        SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains REV-1ullB01       Pfam domains
         Sec.struct. author .hhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                  1ull B  1 TRQARRNRRRRWRERQR 17
                                    10

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (1, 1)

CATH Domains (0, 0)

Pfam Domains (1, 1)

Gene Ontology (9, 9)

NMR Structure(hide GO term definitions)

Chain B (REV_HV1W2 | P05866)

molecular function
	GO:0003723	RNA binding	Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
	GO:0003700	transcription factor activity, sequence-specific DNA binding	Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
	GO:0051028	mRNA transport	The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
	GO:0006355	regulation of transcription, DNA-templated	Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
	GO:0006810	transport	The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
	GO:0016032	viral process	A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
	GO:0030430	host cell cytoplasm	The cytoplasm of a host cell.
	GO:0044196	host cell nucleolus	A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
	GO:0042025	host cell nucleus	A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

Visualization

Interactive Views

NMR Structure
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1ull)

	Sites
(no "Sites" information available for 1ull)

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1ull)

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ NMR Structure - model 1 PNG format \| NMR Structure - all models PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)
Midas
	RNA: ribbon, plates; ligand: dot surface; all models [ stereo GIF format \| mono GIF format \| stereo GIF format ]
Weblab
	surface, molecular electrostatic potential coloring; model 1 [ mono GIF format \| stereo GIF format ]
	RNA: ribbon, lines, labeling; ligand: surface, molecular electrostatic potential coloring; model 1 [ stereo GIF format \| mono GIF format \| stereo GIF format ]
	RNA: ribbon, lines, labeling; ligand: spacefill; model 1 [ stereo GIF format \| mono GIF format \| stereo GIF format ]
	RNA: ribbon, labeling; ligand: ribbon, labeling; model 1 [ mono GIF format \| stereo GIF format ]
	RNA: spacefill; ligand: ribbon, sticks; model 1 [ mono GIF format \| stereo GIF format ]
Distance Plot
	representative atom O3* [ mono GIF format \| mono PDF format ]

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	1ull
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	REV_HV1W2 \| P05866
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	REV_HV1W2 \| P05866
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

Description