Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - manually
(-)NMR Structure - model 1
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - manually
NMR Structure - manually  (Jmol Viewer)
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  SOLUTION STRUCTURE OF HTLV-1 PEPTIDE BOUND TO ITS RNA APTAMER TARGET
 
Authors :  F. Jiang, A. Gorin, W. Hu, A. Majumdar, S. Baskerville, W. Xu, A. Ellington, D. J. Patel
Date :  05 May 00  (Deposition) - 15 May 00  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A,B  (12x)
Keywords :  Arginine-Guanine Sandwich, Extended Bound Basic Rex Peptide, Flap Base, Junctional Base Triplets, Rna Binding Pocket Architecture, Rna Binding Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  F. Jiang, A. Gorin, W. Hu, A. Majumdar, S. Baskerville, W. Xu, A. Ellington, D. J. Patel
Anchoring An Extended Htlv-1 Rex Peptide Within An Rna Major Groove Containing Junctional Base Triples.
Structure Fold. Des. V. 7 1461 1999
PubMed-ID: 10647177  |  Reference-DOI: 10.1016/S0969-2126(00)88337-9
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - RNA APTAMER, 33-MER
    Chains: A
    Engineered: YES
    Other Details: OBTAINED BY IN VITRO SELECTION
    Synthetic: YES
 
Molecule 2 - HTLV-1 REX PEPTIDE
    Chains: B
    Engineered: YES
    Other Details: PEPTIDE FROM HTLV-1 VIRUS PROTEIN
    Synonym: PROTEIN X (HTLV-1), P27 PROTEIN (HTLV-1)
    Synthetic: YES

 Structural Features

(-) Chains, Units

  
NMR Structure (12x): 

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1EXY)

(-) Sites  (0, 0)

(no "Site" information available for 1EXY)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1EXY)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1EXY)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1EXY)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1EXY)

(-) Exons   (0, 0)

(no "Exon" information available for 1EXY)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:33
                                                                 
                 1exy A   1 GGGCGCCGGUACGCAAGUACGACGGUACGCUCC  33
                                    10        20        30   


Chain B from PDB  Type:PROTEIN  Length:16
 aligned with REX_HTL1C | P0C206 from UniProtKB/Swiss-Prot  Length:189

    Alignment length:16
                                    10      
            REX_HTL1C     1 MPKTRRRPRRSQRKRP  16
               SCOP domains d1exyb_ B:       SCOP domains
               CATH domains ---------------- CATH domains
               Pfam domains ---------------- Pfam domains
         Sec.struct. author ........hhhhh... Sec.struct. author
                 SAPs(SNPs) ---------------- SAPs(SNPs)
                    PROSITE ---------------- PROSITE
                 Transcript ---------------- Transcript
                 1exy B 101 MPKTRRRPRRSQRKRP 116
                                   110
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 1)

NMR Structure
(-)
Class: Peptides (792)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1EXY)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1EXY)

(-) Gene Ontology  (8, 8)

NMR Structure(hide GO term definitions)
Chain B   (REX_HTL1C | P0C206)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
biological process
    GO:0051028    mRNA transport    The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1exy)
 
  Sites
(no "Sites" information available for 1exy)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1exy)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ NMR Structure - model 1 PNG format | NMR Structure - all models PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1exy
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  REX_HTL1C | P0C206
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  REX_HTL1C | P0C206
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1EXY)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1EXY)