Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Authors :  Y. Kim, J. H. Geiger, S. Hahn, P. B. Sigler
Date :  28 Sep 94  (Deposition) - 26 Jan 95  (Release) - 24 Feb 09  (Revision)
Resolution :  1.80
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,C  (1x)
Biol. Unit 2:  B,D  (1x)
Keywords :  Protein-Dna Complex, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  Y. Kim, J. H. Geiger, S. Hahn, P. B. Sigler
Crystal Structure Of A Yeast Tbp/Tata-Box Complex.
Nature V. 365 512 1993
PubMed-ID: 8413604  |  Reference-DOI: 10.1038/365512A0
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA (29MER)
    ChainsC, D
    ChainsA, B
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism CommonBAKER'S YEAST
    Organism Taxid4932

 Structural Features

(-) Chains, Units

Asymmetric Unit ABCD
Biological Unit 1 (1x)A C 
Biological Unit 2 (1x) B D

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1YTB)

(-) Sites  (0, 0)

(no "Site" information available for 1YTB)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1YTB)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric Unit
1Glu A:108 -Pro A:109
2Lys A:199 -Pro A:200
3Glu B:108 -Pro B:109
4Lys B:199 -Pro B:200

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1YTB)

(-) PROSITE Motifs  (1, 4)

Asymmetric Unit (1, 4)
1TFIIDPS00351 Transcription factor TFIID repeat signature.TBP_YEAST94-143
Biological Unit 1 (1, 2)
1TFIIDPS00351 Transcription factor TFIID repeat signature.TBP_YEAST94-143
Biological Unit 2 (1, 2)
1TFIIDPS00351 Transcription factor TFIID repeat signature.TBP_YEAST94-143

(-) Exons   (1, 2)

Asymmetric Unit (1, 2)
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:180
 aligned with TBP_YEAST | P13393 from UniProtKB/Swiss-Prot  Length:240

    Alignment length:180
                                    70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240
               SCOP domains d1ytba1 A:61-155 TATA-box binding protein (TBP), C-terminal domain                             d1ytba2 A:156-240 TATA-box binding protein (TBP), C-terminal domain                   SCOP domains
               CATH domains 1ytbA01    1ytbA02 A:72-157 TATA-Binding Protein                                                 1ytbA01 A:61-71,A:158-240 TATA-Binding Protein                                      CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ....eeeeeeeeeeee....hhhhhhhhh.eeee.......eeeee....eeeeee...eeeeee..hhhhhhhhhhhhhhhhhhhh.....eeeeeeeeeeeeee....hhhhhhhhh..eeee.......eeeee....eeeeee...eeeeeee..hhhhhhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ---------------------------------TFIID  PDB: A:94-143 UniProt: 94-143              -----------------------------------------TFIID  PDB: A:185-234 UniProt: 185-234            ------ PROSITE
               Transcript 1 Exon 1.1  PDB: A:61-240 UniProt: 1-240 [INCOMPLETE]                                                                                                                                  Transcript 1
                                    70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240

Chain B from PDB  Type:PROTEIN  Length:180
 aligned with TBP_YEAST | P13393 from UniProtKB/Swiss-Prot  Length:240

    Alignment length:180
                                    70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240
               SCOP domains d1ytbb1 B:61-155 TATA-box binding protein (TBP), C-terminal domain                             d1ytbb2 B:156-240 TATA-box binding protein (TBP), C-terminal domain                   SCOP domains
               CATH domains 1ytbB01    1ytbB02 B:72-157 TATA-Binding Protein                                                 1ytbB01 B:61-71,B:158-240 TATA-Binding Protein                                      CATH domains
           Pfam domains (1) -------------------------------------------------------------------------------------------TBP-1ytbB01 B:152-238                                                                  -- Pfam domains (1)
           Pfam domains (2) -------------------------------------------------------------------------------------------TBP-1ytbB02 B:152-238                                                                  -- Pfam domains (2)
           Pfam domains (3) -------------------------------------------------------------------------------------------TBP-1ytbB03 B:152-238                                                                  -- Pfam domains (3)
           Pfam domains (4) -------------------------------------------------------------------------------------------TBP-1ytbB04 B:152-238                                                                  -- Pfam domains (4)
         Sec.struct. author ....eeeeeeeeeeee....hhhhhhhhh.eeee.......eeeee....eeeeee...eeeeee..hhhhhhhhhhhhhhhhhhhh.....eeeeeeeeeeeeee....hhhhhhhhh..eeee.......eeeee....eeeeee...eeeeeee..hhhhhhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ---------------------------------TFIID  PDB: B:94-143 UniProt: 94-143              -----------------------------------------TFIID  PDB: B:185-234 UniProt: 185-234            ------ PROSITE
               Transcript 1 Exon 1.1  PDB: B:61-240 UniProt: 1-240 [INCOMPLETE]                                                                                                                                  Transcript 1
                                    70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240

Chain C from PDB  Type:DNA  Length:29
                 1ytb C   1 GTATATAAAACGGGTGGCGTTTTATATAC  29
                                    10        20         

Chain D from PDB  Type:DNA  Length:29
                 1ytb D   1 GTATATAAAACGGGTGGCGTTTTATATAC  29
                                    10        20         

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 4)

Asymmetric Unit

(-) CATH Domains  (1, 4)

Asymmetric Unit
Class: Alpha Beta (26913)

(-) Pfam Domains  (1, 4)

Asymmetric Unit
Clan: TBP-like (48)

(-) Gene Ontology  (27, 27)

Asymmetric Unit(hide GO term definitions)
Chain A,B   (TBP_YEAST | P13393)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0008301    DNA binding, bending    The activity of binding selectively and non-covalently to and distorting the original structure of DNA, typically a straight helix, into a bend, or increasing the bend if the original structure was intrinsically bent due to its sequence.
    GO:0001179    RNA polymerase I transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase I transcription factor, any protein required to initiate or regulate transcription by RNA polymerase I.
    GO:0001102    RNA polymerase II activating transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase II transcription activating factor, a protein involved in positive regulation of transcription.
    GO:0000979    RNA polymerase II core promoter sequence-specific DNA binding    Interacting selectively and non-covalently with the regulatory region composed of the transcription start site and binding sites for transcription factors of the RNA polymerase II basal transcription machinery.
    GO:0001016    RNA polymerase III regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that controls the transcription of a gene by RNA polymerase III. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0001026    TFIIIB-type transcription factor activity    Interacting selectively and non-covalently with an RNA polymerase III (Pol III) complex, typically composed of seventeen subunits, and with another protein, macromolecule, or complex, permitting those molecules to function in a coordinated way, Once recruited to an RNA polymerase III promoter by one or more other transcription factors, binds to DNA, recruits RNA polymerase III and facilitates the transition from the closed to the open complex.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0001186    transcription factor activity, RNA polymerase I transcription factor recruiting    The function of binding to an RNA polymerase I (RNAP I) transcription factor and recruiting it to the transcription machinery complex in order to modulate transcription by RNAP I.
    GO:0001075    transcription factor activity, RNA polymerase II core promoter sequence-specific binding involved in preinitiation complex assembly    Interacting selectively and non-covalently with a specific DNA sequence in an RNA polymerase II (Pol II) core promoter, the region composed of the transcription start site and binding sites for transcription factors of the Pol II basal transcription machinery, in order to promote assembly of the transcriptional preinitiation complex (PIC), the formation of which is a prerequisite for transcription from an RNA polymerase II promoter.
biological process
    GO:0006352    DNA-templated transcription, initiation    Any process involved in the assembly of the RNA polymerase preinitiation complex (PIC) at the core promoter region of a DNA template, resulting in the subsequent synthesis of RNA from that promoter. The initiation phase includes PIC assembly and the formation of the first few bonds in the RNA chain, including abortive initiation, which occurs when the first few nucleotides are repeatedly synthesized and then released. The initiation phase ends just before and does not include promoter clearance, or release, which is the transition between the initiation and elongation phases of transcription.
    GO:0051123    RNA polymerase II transcriptional preinitiation complex assembly    The aggregation, arrangement and bonding together of proteins on an RNA polymerase II promoter DNA to form the transcriptional preinitiation complex (PIC), the formation of which is a prerequisite for transcription by RNA polymerase.
    GO:0070898    RNA polymerase III transcriptional preinitiation complex assembly    The aggregation, arrangement and bonding together of proteins on promoter DNA to form the transcriptional preinitiation complex (PIC), the formation of which is a prerequisite for transcription from an RNA polymerase III promoter.
    GO:0006356    regulation of transcription from RNA polymerase I promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase I promoter.
    GO:0006359    regulation of transcription from RNA polymerase III promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA ploymerase III promoter.
    GO:0006385    transcription elongation from RNA polymerase III promoter    The extension of an RNA molecule after transcription initiation and promoter clearance at an RNA polymerase III promoter by the addition of ribonucleotides catalyzed by RNA polymerase III.
    GO:0006383    transcription from RNA polymerase III promoter    The synthesis of RNA from a DNA template by RNA polymerase III, originating at an RNAP III promoter.
    GO:0042790    transcription of nuclear large rRNA transcript from RNA polymerase I promoter    The synthesis of the large ribosomal RNA (rRNA) transcript which encodes several rRNAs, e.g. in mammals 28S, 18S and 5.8S, from a nuclear DNA template transcribed by RNA polymerase I.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
    GO:0070893    transposon integration    Any process in which a transposable element is incorporated into another DNA molecule such as a chromosome.
cellular component
    GO:0070860    RNA polymerase I core factor complex    A RNA polymerase I-specific transcription factor complex that is required for the transcription of rDNA by RNA polymerase I. In yeast the complex consists of Rrn6p, Rrn7p, and Rrn11p.
    GO:0000500    RNA polymerase I upstream activating factor complex    A complex required for the transcription of rDNA by RNA polymerase I. In yeast the complex consists of Rrrn5p, Rrn9p, Rrn10p, histones H3 and H4, and Uaf30p.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005669    transcription factor TFIID complex    A complex composed of TATA binding protein (TBP) and TBP associated factors (TAFs); the total mass is typically about 800 kDa. Most of the TAFs are conserved across species. In TATA-containing promoters for RNA polymerase II (Pol II), TFIID is believed to recognize at least two distinct elements, the TATA element and a downstream promoter element. TFIID is also involved in recognition of TATA-less Pol II promoters. Binding of TFIID to DNA is necessary but not sufficient for transcription initiation from most RNA polymerase II promoters.
    GO:0000126    transcription factor TFIIIB complex    A transcription factor complex that is involved in regulating transcription from RNA polymerase III (Pol III) promoters. TFIIIB contains the TATA-binding protein (TBP) and two Pol III-specific proteins, B'' and BRF.


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1ytb)
(no "Sites" information available for 1ytb)
  Cis Peptide Bonds
    Glu A:108 - Pro A:109   [ RasMol ]  
    Glu B:108 - Pro B:109   [ RasMol ]  
    Lys A:199 - Pro A:200   [ RasMol ]  
    Lys B:199 - Pro B:200   [ RasMol ]  
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
  protein: ribbon, secondary structure; DNA: ribbon, plates
  protein: ribbon; DNA: ribbon, sticks
  ribbon, labeling
  protein: sticks; DNA spacefill
Distance Plot
  representative atom: CA, O3'

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  TBP_YEAST | P13393
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  TBP_YEAST | P13393
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        TBP_YEAST | P133931ngm 1nh2 1rm1 1tba 1tbp 1ytf 4b0a 4v1n 4v1o 5fmf 5fyw 5fz5 5sva

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1YTB)