Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - model 1
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  NMR STRUCTURE OF THE APOB MRNA STEM-LOOP AND ITS INTERACTION WITH THE C TO U EDITING APOBEC1 COMPLEMENTARY FACTOR
 
Authors :  C. Maris, J. Masse, F. H. Allain, A. Chester, N. Navaratnam
Date :  24 Jan 05  (Deposition) - 08 Feb 05  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A  (16x)
Keywords :  Rna Editing; Apob Mrna; Apobec1; Acf; Nmr Structure (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  C. Maris, J. Masse, A. Chester, N. Navaratnam, F. H. Allain
Nmr Structure Of The Apob Mrna Stem-Loop And Its Interaction With The C To U Editing Apobec1 Complementary Factor.
Rna V. 11 173 2005
PubMed-ID: 15659357  |  Reference-DOI: 10.1261/RNA.7190705
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - APOLIPOPROTEIN B MRNA
    ChainsA
    EngineeredYES
    FragmentEDITING SITE OF APOBEC-1 ENZYME
    Other DetailsIN VITRO T7 POLYMERASE TRANSCRIPTION. THE SEQUENCE OF THIS RNA NATURALLY EXISTS IN HOMO SAPIENS (HUMAN).
    SynonymAPOB MRNA
    SyntheticYES

 Structural Features

(-) Chains, Units

  
NMR Structure (16x)

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1YNG)

(-) Sites  (0, 0)

(no "Site" information available for 1YNG)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1YNG)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1YNG)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1YNG)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1YNG)

(-) Exons   (0, 0)

(no "Exon" information available for 1YNG)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:31
                                                              
                  1yng A  1 GGAUAUAUGAUAUAAUUUGAUCAGUAUAUCC 31
                                    10        20        30 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 1YNG)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1YNG)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1YNG)

(-) Gene Ontology  (0, 0)

NMR Structure(hide GO term definitions)
    (no "Gene Ontology" information available for 1YNG)

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1yng)
 
  Sites
(no "Sites" information available for 1yng)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1yng)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1yng
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1YNG)

(-) Related Entries Specified in the PDB File

1ylg UNEDITED APOB MRNA STRUCTURE (G19 ANTI CONFORMATION)
1ync UNEDITED APOB MRNA STRUCTURE (G19 SYN CONFORMATION)
1yne EDITED APOB MRNA STRUCTURE (G19 ANTI CONFORMATION)