Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
(-)Biological Unit 3
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)
Image Biological Unit 3
Biological Unit 3  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF A MUTANT OF THE SARCIN/RICIN DOMAIN FROM RAT 28S RRNA
 
Authors :  C. C. Correll, J. Beneken, M. J. Plantinga, M. Lubbers, Y. L. Chan
Date :  22 Aug 03  (Deposition) - 25 Nov 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.75
Chains :  Asym. Unit :  A,B,C
Biol. Unit 1:  A  (1x)
Biol. Unit 2:  B  (1x)
Biol. Unit 3:  C  (1x)
Keywords :  Sarcin/Ricin Domain, Ribonucleic Acid, Rna Recognition, Ribosomes, Elongation Factors, Mutant, Stem Loop (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  C. C. Correll, J. Beneken, M. J. Plantinga, M. Lubbers, Y. L. Chan
The Common And Distinctive Features Of The Bulged-G Motif Based On A 1. 04 A Resolution Rna Structure
Nucleic Acids Res. V. 31 6806 2003
PubMed-ID: 14627814  |  Reference-DOI: 10.1093/NAR/GKG908
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - SARCIN/RICIN 28S RRNA
    ChainsA, B, C
    EngineeredYES
    FragmentSARCIN/RICIN DOMAIN
    MutationYES
    Other DetailsTHE 28S RIBOSOMAL RNA WAS CHEMICALLY SYNTHESIZED. THE SEQUENCE OF THE 28S RIBOSOMAL RNA IS NATURALLY FOUND IN RATTUS RATTUS (RAT).
    SyntheticYES

 Structural Features

(-) Chains, Units

  123
Asymmetric Unit ABC
Biological Unit 1 (1x)A  
Biological Unit 2 (1x) B 
Biological Unit 3 (1x)  C

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 4)

Asymmetric Unit (1, 4)
No.NameCountTypeFull Name
1SO44Ligand/IonSULFATE ION
Biological Unit 1 (1, 2)
No.NameCountTypeFull Name
1SO42Ligand/IonSULFATE ION
Biological Unit 2 (1, 1)
No.NameCountTypeFull Name
1SO41Ligand/IonSULFATE ION
Biological Unit 3 (1, 1)
No.NameCountTypeFull Name
1SO41Ligand/IonSULFATE ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREA A:15 , G A:16 , A A:17 , HOH A:356 , HOH A:395 , G C:2 , G C:3 , HOH C:316BINDING SITE FOR RESIDUE SO4 C 311
2AC2SOFTWAREG A:2 , C A:27 , C A:28 , HOH A:327 , HOH A:331 , HOH A:358 , HOH C:362 , HOH C:381BINDING SITE FOR RESIDUE SO4 A 312
3AC3SOFTWAREG B:16 , A B:17BINDING SITE FOR RESIDUE SO4 B 313
4AC4SOFTWAREC A:23 , G A:24BINDING SITE FOR RESIDUE SO4 A 314

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1Q96)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1Q96)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1Q96)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1Q96)

(-) Exons   (0, 0)

(no "Exon" information available for 1Q96)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:27
                                                          
                  1q96 A  2 GGUGCUCAGUAUGAGAAGAACCGCACC 28
                                    11        21       

Chain B from PDB  Type:RNA  Length:27
                                                          
                  1q96 B  2 GGUGCUCAGUAUGAGAAGAACCGCACC 28
                                    11        21       

Chain C from PDB  Type:RNA  Length:27
                                                          
                  1q96 C  2 GGUGCUCAGUAUGAGAAGAACCGCACC 28
                                    11        21       

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 1Q96)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1Q96)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1Q96)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 1Q96)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    SO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1q96)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]
    Biological Unit 3  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1q96
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1Q96)

(-) Related Entries Specified in the PDB File

1jbr CRYSTAL STRUCTURE OF THE RIBOTOXIN RESTRICTOCIN AND A 31- MER SRD RNA INHIBITOR
1jbs CRYSTAL STRUCTURE OF RIBOTOXIN RESTRICTOCIN AND A 29-MER SRD RNA ANALOG
1msy GUAA TETRALOOP MUTANT OF SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA
1q93 CRYSTAL STRUCTURE OF A MUTANT OF THE SARCIN/RICIN DOMAIN FROM RAT 28S RRNA
1q9a CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E.COLI 23S RRNA AT 1.04 RESOLUTION
480d CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA
483d CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA