Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Authors :  B. Chevalier, M. Turmel, C. Lemieux, R. J. Monnat, B. L. Stoddard
Date :  10 Jul 02  (Deposition) - 03 Jun 03  (Release) - 13 Jul 11  (Revision)
Resolution :  2.25
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Laglidadg, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  B. Chevalier, M. Turmel, C. Lemieux, R. J. Monnat, B. L. Stoddard
Flexible Dna Target Site Recognition By Divergent Homing Endonuclease Isoschizomers I-Crei And I-Msoi
J. Mol. Biol. V. 329 253 2003
PubMed-ID: 12758074  |  Reference-DOI: 10.1016/S0022-2836(03)00447-9

(-) Compounds

    ChainsA, B
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPI-MSOI
    Expression System StrainBL21[DE3]
    Expression System Taxid562
    Expression System Vector TypePLASMID
    Organism ScientificMONOMASTIX SP.
    Organism Taxid141716

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 3)

Asymmetric/Biological Unit (1, 3)
No.NameCountTypeFull Name

(-) Sites  (3, 3)

Asymmetric Unit (3, 3)
1AC1SOFTWAREASP A:22 , GLY B:221 , HOH B:1225 , DA C:514 , CA C:801 , DG D:565 , HOH D:1228BINDING SITE FOR RESIDUE CA A 802
2AC2SOFTWAREGLY A:21 , ASP B:222 , HOH B:1227 , DG C:515 , CA C:801 , HOH C:1226 , DC D:564BINDING SITE FOR RESIDUE CA B 803
3AC3SOFTWAREASP A:22 , CA A:802 , ASP B:222 , CA B:803 , DA C:514 , DG C:515 , DC D:564 , DG D:565BINDING SITE FOR RESIDUE CA C 801

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1M5X)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1M5X)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1M5X)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1M5X)

(-) Exons   (0, 0)

(no "Exon" information available for 1M5X)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:161
 aligned with C0JWR6_MONSK | C0JWR6 from UniProtKB/TrEMBL  Length:170

    Alignment length:161
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165 
               SCOP domains d1m5xa_ A: DNA endonuclease I-MsoI                                                                                                                                SCOP domains
               CATH domains 1m5xA00 A:6-166 Homing endonucleases                                                                                                                              CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhheeeeeeeee........eeeeeeeeeeee..hhhhhhhhhhhh....eee......eeeeeeehhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165 

Chain B from PDB  Type:PROTEIN  Length:161
 aligned with C0JWR6_MONSK | C0JWR6 from UniProtKB/TrEMBL  Length:170

    Alignment length:161
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165 
               SCOP domains d1m5xb_ B: DNA endonuclease I-MsoI                                                                                                                                SCOP domains
               CATH domains 1m5xB00 B:206-366 Homing endonucleases                                                                                                                            CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhheeeeeeeee........eeeeeeeeeeee..hhhhhhhhhhhh....eee......eeeeeeehhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                   215       225       235       245       255       265       275       285       295       305       315       325       335       345       355       365 

Chain C from PDB  Type:DNA  Length:24
                 1m5x C 501 GCAGAACGTCGTGAGACAGTTCCG 524
                                   510       520    

Chain D from PDB  Type:DNA  Length:24
                 1m5x D 551 CGGAACTGTCTCACGACGTTCTGC 574
                                   560       570    

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit
Class: Alpha Beta (26913)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1M5X)

(-) Gene Ontology  (4, 4)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (C0JWR6_MONSK | C0JWR6)
molecular function
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
biological process
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.
cellular component
    GO:0009507    chloroplast    A chlorophyll-containing plastid with thylakoids organized into grana and frets, or stroma thylakoids, and embedded in a stroma.
    GO:0009536    plastid    Any member of a family of organelles found in the cytoplasm of plants and some protists, which are membrane-bounded and contain DNA. Plant plastids develop from a common type, the proplastid.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1m5x)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/TrEMBL
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        C0JWR6_MONSK | C0JWR62fld 3fd2 3ko2

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1M5X)